- Research article
- Open access
- Published:
Targeted disruption of Tbc1d20with zinc-finger nucleases causes cataracts and testicular abnormalities in mice
BMC Genetics volume 15, Article number: 135 (2014)
Abstract
Background
Loss-of-function mutations in TBC1D20 cause Warburg Micro syndrome 4 (WARBM4), which is an autosomal recessive syndromic disorder characterized by eye, brain, and genital abnormalities. Blind sterile (bs) mice carry a Tbc1d20-null mutation and exhibit cataracts and testicular phenotypes similar to those observed in WARBM4 patients. In addition to TBC1D20, mutations in RAB3GAP1, RAB3GAP2 and RAB18 cause WARBM1-3 respectively. However, regardless of which gene harbors the causative mutation, all individuals affected with WARBM exhibit indistinguishable clinical presentations. In contrast, bs, Rab3gap1 -/-, and Rab18 -/- mice exhibit distinct phenotypes; this phenotypic variability of WARBM mice was previously attributed to potential compensatory mechanisms. Rab3gap1 -/- and Rab18 -/- mice were genetically engineered using standard approaches, whereas the Tbc1d20 mutation in the bs mice arose spontaneously. There is the possibility that another unidentified mutation within the bs linkage disequilibrium may be contributing to the bs phenotypes and thus contributing to the phenotypic variability in WARBM mice. The goal of this study was to establish the phenotypic consequences in mice caused by the disruption of the Tbc1d20 gene.
Results
The zinc finger nuclease (ZFN) mediated genomic editing generated a Tbc1d20 c.[418_426del] deletion encoding a putative TBC1D20-ZFN protein with an in-frame p.[H140_Y143del] deletion within the highly conserved TBC domain. The evaluation of Tbc1d20 ZFN/ZFN eyes identified severe cataracts and thickened pupillary sphincter muscle. Tbc1d20 ZFN/ZFN males are infertile and the analysis of the seminiferous tubules identified disrupted acrosomal development. The compound heterozygote Tbc1d20 ZFN/bs mice, generated from an allelic bs/+ X Tbc1d20 ZFN/+ cross, exhibited cataracts and aberrant acrosomal development indicating a failure to complement.
Conclusions
Our findings show that the disruption of Tbc1d20 in mice results in cataracts and aberrant acrosomal formation, thus establishing bs and Tbc1d20 ZFN/ZFN as allelic variants. Although the WARBM molecular disease etiology remains unclear, both the bs and Tbc1d20 ZFN/ZFN mice are excellent model organisms for future studies to establish TBC1D20-mediated molecular and cellular functions.
Background
Warburg Micro syndrome (WARBM) is a genetically heterogeneous autosomal recessive syndromic disorder characterized by eye, brain, and genital abnormalities [1]. Mutations in RAB3GAP1, RAB3GAP2, RAB18, and TBC1D20 genes cause WARBM1, WARBM2, WARBM3, and WARBM4 forms respectively [2]-[5]. Regardless which of the four genes harbors the causative mutation, all WARBM individuals present with indistinguishable clinical features [1],[5]. Eye abnormalities in WARBM children are characterized by congenital cataracts, microphakia, microcornea, microphthalmia, optic nerve atrophy, and small, atonic pupils [6],[7]. Postnatal microcephaly, predominantly frontal polymicrogyria, corpus callosum hypogenesis, enlarged subdural spaces, cerebellar vermis hypoplasia are brain characteristics in the affected WARBM children; these abnormalities are accompanied by seizures and severe intellectual disability [8]-[10]. Microgentialia is present in both the WARBM affected boys and girls [1],[7],[9]. In addition to eye, brain and genital abnormalities, WARBM children also exhibit hypotonia of truncal muscles, as well as spasticity of the limbs resulting in the inability to walk, sit, or crawl, and ultimately resulting in quadriplegia [1].
Mouse models of human genetic disorders are excellent resources for elucidation of the molecular and cellular disease etiologies. Recently, we reported that blind sterile (bs) mice, initially identified over 30Â years ago as a spontaneous autosomal recessive mouse mutation exhibiting cataracts [11],[12] and male infertility [13],[14], carry a loss of function mutation in the Tbc1d20 gene [5]. The bs mice recapitulate the lens and testicular phenotypes observed in the WARBM4 children, although no morphological brain abnormalities were noted [5]. Rab3gap1 -/- mice do not exhibit any morphological abnormalities of the eyes, brain, or genitalia, but exhibit synaptic exocytosis abnormalities [15]. Recently, it was shown that Rab18 -/- mice exhibit cataracts, atonic pupils, and progressive hind limb weakness associated with accumulations of neurofilament and microtubules in the synaptic terminals [16]. This phenotypic variability between mice with disrupted WARBM genes has been previously attributed to gene-specific and species-specific compensatory mechanisms present in mice [4],[5].
Rab3gap1 -/- and Rab18 -/- mice are mouse models that were genetically engineered using standard approaches [15],[16]. In contrast, the Tbc1d20 mutation in the bs mouse arose spontaneously [11]. Our genetic analysis of the bs mice identified a 416 kb genomic region in linkage disequilibrium within the bs locus [5]. The analysis of the bs critical region identified 16 RefSeq candidate genes and further evaluation of the candidate genes focused on the sequencing of the exons and exon/intron boundaries as well as RT-PCR analysis and subsequent sequencing of the open reading frames [5]. This approach identified a c.[691 T > A; 692_703del] mutation in the Tbc1d20 gene as causing the bs phenotype; subsequent functional analysis of the TBC1D20-bs protein determined that the bs mutation results in the loss of TBC1D20 functional [5]. Given that we did not sequence the entire 416 kb bs critical region, we cannot eliminate the possibility that another mutation not residing within the exon/intron regions or open reading frames of the 16 candidate genes, but resides within the bs linkage disequilibrium region, may be contributing to the phenotypic differences between the bs, Rab3gap1 -/-, and Rab18 -/- mice.
As a part of this study, we set out to unequivocally establish the phenotypic consequences caused by the disruption of the Tbc1d20 gene. We utilized the zinc-finger nuclease (ZFN)-mediated genomic editing approach to generate the Tbc1d20 ZFN/ZFN mice. Our results show that the Tbc1d20 ZFN/ZFN mice exhibit cataracts and testicular phenotypes indistinguishable from the cataract and testicular phenotypes identified in the bs mice. Additionally, the complementation analysis confirmed that the bs and Tbc1d20 ZFN/ZFN mice are allelic variants.
Results and discussion
ZFN-mediated disruption of the Tbc1d20locus
The ZFN mediated targeting of the Tbc1d20 gene (NM_024196) was designed to cut a 6 bp region within exon 4 (see Methods). This approach generated 3 Tbc1d20 ZFN founder mice with a 9 bp c.[418_426del] deletion (Figure 1A). The Tbc1d20 ZFN transcript encodes a putative TBC1D20-ZFN protein with an in-frame 3 amino acid deletion p.[H140_Y143del] within a highly evolutionarily conserved TBC domain (Figure 1B). TBC1D20 is an ER associated protein that functions as a GTPase activating protein (GAP) enhancing the GTP hydrolysis rate when bound to RAB1 or RAB2 [5],[17],[18]. It was shown previously that overexpression of mouse or human TBC1D20-WT protein results in the disruption of Golgi structures [5],[17]. It was also shown that overexpression of the catalytically inactive mouse or human TBC1D20 proteins did not have an effect on the Golgi morphology [5],[17]. Therefore, we proceeded to evaluate the effects of overexpression of the FLAG-tagged TBC1D20-WT and TBC1D20-ZFN proteins of Golgi structures in the HeLa cells. FLAG immunostaining confirmed the ER pattern of expression for both TBC1D20-WT and TBC1D20-ZFN proteins (Figure 1C-D). HeLa cells overexpressing of the FLAG-tagged TBC1D20-WT protein exhibited disrupted Golgi structures and only residual GM130 immunostaining (Figure 1C). In contrast, both untransfected (Figure 1E) and HeLa cells overexpressing the FLAG-tagged TBC1D20-ZFN protein exhibited similar GM130 immunostaining pattern (Figure 1D) suggesting that TBC1D20-ZFN did not disrupt Golgi structures. Therefore, these findings suggested that TBC1D20-ZFN catalytic function was disrupted.
Eye, testicular, and brain phenotypes in Tbc1d20 ZFN/ZFNmice
The Tbc1d20 ZFN/+ heterozygote mice did not phenotypically differ from the WT mice. The het to het breedings of the Tbc1d20 ZFN/+ mice recovered Tbc1d20 +/+ (n = 13), Tbc1d20 ZFN/+ (n = 27), and Tbc1d20 ZFN/ZFN (n = 10) progeny and these ratios did not significantly differ, following a chi-squared test, from expected ratios for a Mendelian autosomal recessive locus. Following the eyelid opening around postnatal day P14, clinical eye evaluation identified nuclear cataracts only in Tbc1d20 ZFN/ZFN that by P28 progressed to total cataracts characterized by vacuoles present throughout the entire lens (not shown). Histological analysis of Tbc1d20 ZFN/ZFN eyes confirmed severely disrupted vacuolated lenses with ruptured lens capsule and lenticular material in the vitreal cavity (Figure 2B) although some lenticular material was also present in the anterior chamber (Figure 2F). Lens epithelial cells did not appear to exhibit any gross morphological abnormalities whereas cortical and nuclear fiber cells were severely shortened and disorganized (Figure 2D). Although retinal dismorphology and rosetting were evident in Tbc1d20 ZFN/ZFN eyes (Figure 2B), the retina was laminated suggesting that rosetting may have been caused by the lens rupture and not by a defect in retinal development. Tbc1d20 ZFN/ZFN eyes also exhibited thickened pupillary sphincter muscle (Figure 2F) that was not previously identified in bs eyes [5] suggesting that this TBC1D20-associated phenotype may be influenced by genetic modifiers.
Tbc1d20 ZFN/ZFN females were able to produce litters and Tbc1d20 ZFN/ZFN males did not suggesting that the Tbc1d20 ZFN/ZFN males may be infertile. We proceeded to evaluate the Tbc1d20 ZFN/ZFN testes. Upon observation, the Tbc1d20 ZFN/ZFN testes appeared smaller in size when compared to control testes (Figure 3A). Histological evaluation revealed disorganized Tbc1d20 ZFN/ZFN seminiferous tubules (Figure 3C). Male infertility in TBC1D20-deficient bs mice was caused by a disruption in acrosomal formation [5],[13],[14], thus, we proceeded to evaluate the maturation of the spermatozoa in the Tbc1d20 ZFN/ZFN seminiferous tubules. Immunostaining with TRA54, a haploid sperm cell-specific antigen [19], of control seminiferous tubules revealed punctate (not shown) and crescent-shaped staining (Figure 3D) characteristic of spermatocytes and round spermatids respectively [19]. In contrast, immunostaining for TRA54 in Tbc1d20 ZFN/ZFN seminiferous tubules revealed only punctate staining (Figure 3E). Peanut agglutinin (PNA) is a marker for acrosomes [20]; PNA staining of the seminiferous tubules in the controls revealed a characteristic crescent acrosomal shape (Figure 3F) whereas inTbc1d20 ZFN/ZFN seminiferous tubules only the PNA positive punctae were evident (Figure 3G). The observed testicular phenotypes of Tbc1d20 ZFN/ZFN were indistinguishable from the testicular phenotypes reported for the bs mice [5],[13],[14].
Evaluation of the Tbc1d20 ZFN/ZFN brains did not identify any gross morphological abnormalities (not shown). Collectively these findings indicated that in Tbc1d20 ZFN/ZFN mice eye and testicular phenotypes are fully penetrant without any brain morphological abnormalities consistent with findings previously reported for bs mice [5].
Cellular phenotypes of Tbc1d20 ZFN/ZFNMEFs
An accumulation of enlarged lipid droplets (LDs) following oleic acid supplementation was the only cellular abnormality in the skin-derived TBC1D20-deficient fibroblasts from a WARBM4 patient [5]. Primary bs MEFs also exhibit an accumulation of enlarged LDs following treatment with oleic acid, but additionally the bs MEFs also exhibited enlarged Golgi structures [5]. Therefore, we proceeded to evaluate the LD and Golgi morphology in control and Tbc1d20 ZFN/ZFN MEFs. Our analysis confirmed a significant accumulation of enlarged LDs in the Tbc1d20 ZFN/ZFN MEFs (Figure 4B) when compared to the LDs in the MEFs from the control mice (Figure 4C) 24 h following oleic acid treatment and subsequent staining with the neutral lipid dye BODIPY 493/503. However, we did not observe any difference in the Golgi structures between control and Tbc1d20 ZFN MEFs following immunostaining with GM130 (Figure 4D and F). Western blot analysis confirmed there was no difference in levels of GM130 protein in control and Tbc1d20 ZFN MEF cell lysates (not show). Although bs MEFs exhibited enlargement of Golgi structures, Golgi structures in the TBC1D20-deficient skin fibroblasts from a WARBM4 patient did not differ from Golgi structures in control skin fibroblasts [5]. However, thickened Golgi ribbons were observed in HeLa cells following shRNA mediated TBC1D20 knock-down [17]. Collectively these findings indicate that a spectrum of Golgi phenotypes is associated with TBC1D20 functional deficiency indicating that this phenotype is most likely influenced by genetic modifiers.
Complementation analysis
To determine if bs and Tbc1d20 ZFN mice are allelic variants, we set up complementation breedings. A cross between bs/+ and Tbc1d20 ZFN/+ mice led to Tbc1d20 ZFN/bs (n = 4), Tbc1d20 +/+ (n = 3), Tbc1d20 ZFN/+ (n = 2), and Tbc1d20 bs/+ (n = 3) progeny. Clinical eye evaluation (not shown) as well as histological eye analysis identified vacuolated cataracts in the Tbc1d20 ZFN/bs compound heterozygous mice (Figure 5B) phenotypically similar to the Tbc1d20 ZFN/ZFN cataracts (Figure 2B) as well as bs cataracts [5]. The compound heterozygous Tbc1d20 ZFN/bs mice did not exhibit pupillary thickening observed in Tbc1d20 ZFN/ZFN (not shown). The testes from the Tbc1d20 bs/ZFN compound heterozygote males appeared smaller in size when compared to controls (Figure 5C). Histological analysis revealed disorganized Tbc1d20 ZFN/bs seminiferous tubules (Figure 5). Tbc1d20 ZFN/bs seminiferous tubules immnunostaining with TRA54 (Figure 5G) and staining with PNA (Figure 5I) identified disrupted acrosomal formation phenotypically indistinguishable from the findings in Tbc1d20 ZFN/ZFN (Figure 3A,C,E and G) and bs males [5].
Conclusions
In mice, the disruption of Tbc1d20 results in vacuolated cataracts and a defect in acrosomal formation resulting in male infertility. At the cellular level, disruption of Tbc1d20 resulted in an accumulation of LDs. Thickening of the pupillary sphincter muscle eye phenotypes and aberrant Golgi cellular phenotypes were not penetrant on all genetic backgrounds suggesting that these phenotypes, caused by disruption of Tbc1d20, may be influenced by genetic modifiers. Although molecular and cellular disease etiology caused by TBC1D20 functional deficiency in mice and humans remains unclear, bs and Tbc1d20 ZFN/ZFN mice are allelic variants and as such are excellent model organisms for future studies focusing on elucidating TBC1D20 function.
Methods
Mice
To target the mouse Tbc1d20 (NM_024196.3) gene, ZFN plasmid design, assembly, validation and mRNA was done by the CompoZr Custom ZFN Service (Sigma). The ZFNs were designed to cut the c.[419ACTACT424] sequence within exon 4. The Tbc1d20 targeting ZFN mRNA was injected into the B6D2F1/Crl (F1 het from C57BL/6 N and DBA2 strains) embryos, which were implanted into pseudo-pregnant females. Pups were genotyped using standard conditions with ZFN-F 5′CTGGGTGTCATGAGCAATGT3′ and ZFN-R 5′AGGAGGCTGAGGAGTGACCT3′ primers, electrophoresed, gel purified using the QIAquick Gel Extraction Kit (Qiagen), and screened for mutations using the Cel1 nucleotide mismatch assay (Sigma). The founders were confirmed by Sanger sequencing (Retrogen). Tbc1d20 ZFN/+ did not differ phenotypically from Tbc1d20 +/+ mice and both genotypes were used as controls. RNA was isolated from spleen, kidney, liver, and testes and the Tbc1d20 transcript was reverse transcribed, PCR-amplified and sequenced as previously described [5]. Comparative sequence analysis was performed using DNAStar software. Allelic breedings utilized bs/+ mice previously obtained from Jackson Laboratories and the bs allele was genotyped as previously described [5]. The treatment and use of all animals in this study was compliant with all protocols and provisions approved by the Institutional Animal Care and Use Committee (IACUC) at the Medical College of Wisconsin.
Clinical evaluations, histology, and immunohistochemistry
Mouse eyes were examined with a Topcon SL-D8Z slit lamp biomicroscope with a Nikon SLR-based Photo Slit Lamp imaging system following mydriasis with 1% Atropine Sulfate (Bausch & Lomb). Eyes, brains, and testes were collected at 8 weeks of age. Eyes and testes were fixed in 4% paraformaldehyde (PFA), paraffin embedded and H&E stained as previously described [5]. Brains were fixed at 4°C for 24 h in 4% PFA followed by 30% sucrose for 24-72 hrs. Brains were then sectioned at 30 μm on a sliding microtome (Leica) and stained with DAPI to label all nuclei. Immunostaining was done with TRA54 (B-Bridge) as a primary antibody and DyLight 488 goat anti-rat (Abcam) as a secondary antibody following the manufacturer’s recommendations. PNA staining was performed utilizing the Lectin PNA-Alexa-488 conjugate (Life Technologies) according to the manufacturer’s recommendations. Slides were DAPI stained according to the manufacturer’s recommendations (Life Technologies), mounted using Fluoromount-G (Southern Biotech), and imaged using a Nikon DS-Fi1 camera on a Nikon Eclipse 80i microscope using NIS-Elements software (Nikon).
Functional analysis of the Tbc1d20 ZFNallele
To generate an N-terminal FLAG-tagged Tbc1d20 clone, Tbc1d20 (BC034504.1) clone MGC: 25843/IMAGE: 4192736 (Open Biosystems) was PCR-amplified utilizing PCR primers (F 5′AAGCTTGCGGCCGCGGCCCTCCGGCCCTCAAAG3′ and R 5′GGATCCTCTAGATTAGGGGAACAGCTGCAGCTG3) to incorporate a 5′ NotI restriction site and 3′ XbaI site. The PCR product was subcloned via directional ligation into the NotI and XbaI sites in the MCS of pFLAG-CMV-2 (Sigma-Aldrich). Mutagenesis to introduce the ZFN deletion was performed with the Phusion Site-Directed Mutagenesis Kit (Finnzymes) using F5′Phos-CAGGGCTACCATGACATCGTGGTCACATTT3′ and R5′Phos-GAGCTGAGGGTTGCGATCCAGGACGAGGAG3′ primers. Generated clones were confirmed by Sanger sequencing.
HeLa cells were cultured in DMEM containing 10% fetal bovine serum at 37°C and 5%CO2. For transfections, HeLa cells were grown on glass slides in 12-well plates and transfected with Lipofectamine LTX (Life Technologies) following the manufacturer’s recommendations. Following transfections, the coverslips were washed with 1XPBS, then fixed with 4% PFA in PBS pH7.4 for 15 minutes at room temperature, washed with ice cold 1XPBS, permeabilized with 0.25% Triton X-100 in PBS (PBST), and then washed with 1X PBS for 3X5 minutes. The coverslips were immunostained with FLAG (Sigma) and GM 130 (Abcam) antibodies overnight at 4°C and for 1 hr at RT, with Alexa 488 and 546-conjugated (Life Technologies) secondary antibodies following the manufacturer’s recommendations. The coverslips were stained with DAPI for 5 min, washed with 1XPBS, mounted onto glass slides with Fluoromount-G mounting medium, and photographed with a Nikon DS-Fi1 camera on a Nikon Eclipse 80i microscope.
Mouse embryonic fibroblasts (MEFs)
MEFs were isolated from the E13.5 mouse embryos (from the Tbc1d20 ZFN/+X Tbc1d20 ZFN/+ cross) that genotyped either Tbc1d20 ZFN/ZFNor Tbc1d20 +/+ and were maintained as previously described [5],[21]. Lipid droplets were evaluated as described previously utilizing media supplemented with 400 μM oleic acid (Sigma Aldrich) for 24 h and stained with 1 μg/μL BODIPY 493/503 (Life Technologies) [5]. All slides were mounted using Vectashield with DAPI (Vector Labs). Imaging was done with a Nikon DS-Fi1 camera on a Nikon Eclipse 80i microscope using NIS-Elements software (Nikon). Quantification of the lipid droplets was performed as previously described [22] using ImageJ (US National Institutes of Health) and NIS-Elements software. For each analysis, at least 20 cells per genotype were evaluated and statistical significance was determined by a t-test (Graphpad Prism) where p < 0.05 was treated as significant. For Golgi analysis, the control and Tbc1d20 ZFN/ZFN MEFs were immunostained using GM130 (Abcam) primary antibody and Alexa 488-conjugated secondary antibody (Life Technologies) following manufacturers’ recommendations. Western blots were run using cell lysates generated from control and Tbc1d20 ZFN/ZFN MEFs following lysis with RIPA buffer supplemented with a protease inhibitor cocktail (Sigma). Cell lysates were immunoblotted with GM130 (BD Biosciences) primary antibody and HRP-conjugated secondary antibody (Abcam) following the manufacturer’s recommendations as previously described [5]. Even loading was established following immunoblotting with β-actin HPR conjugated antibody (Abcam). The detection was performed using the ECL Western Blot Analysis System (Amersham) following the manufacturer’s instructions.
Abbreviations
- WARBM4:
-
Warburg Micro syndrome 4
- bs :
-
blind sterile
- ZFN:
-
Zinc finger nuclease
- WARBM:
-
Warburg Micro syndrome
- GAP:
-
GTPase activating protein
- PNA:
-
Peanut agglutinin
- LDs:
-
Lipid droplets
References
Handley MT, Morris-Rosendahl DJ, Brown S, Macdonald F, Hardy C, Bem D, Carpanini SM, Borck G, Martorell L, Izzi C, Faravelli F, Accorsi P, Pinelli L, Basel-Vanagaite L, Peretz G, Abdel-Salam GM, Zaki MS, Jansen A, Mowat D, Glass I, Stewart H, Mancini G, Lederer D, Roscioli T, Giuliano F, Plomp AS, Rolfs A, Graham JM, Seemanova E, Jackson IJ, et al: Mutation spectrum in RAB3GAP1, RAB3GAP2 and RAB18 and genotype-phenotype correlations in Warburg micro syndrome and Martsolf syndrome. Hum Mutat. 2013, 34 (5): 686-696. 10.1002/humu.22296.
Aligianis IA, Johnson CA, Gissen P, Chen D, Hampshire D, Hoffmann K, Maina EN, Morgan NV, Tee L, Morton J, Ainsworth JR, Horn D, Rosser E, Cole TR, Stolte-Dijkstra I, Fieggen K, Clayton-Smith J, Megarbane A, Shield JP, Newbury-Ecob R, Dobyns WB, Graham JM, Kjaer KW, Warburg M, Bond J, Trembath RC, Harris LW, Takai Y, Mundlos S, Tannahill D, et al: Mutations of the catalytic subunit of RAB3GAP cause Warburg Micro syndrome. Nat Genet. 2005, 37 (3): 221-223. 10.1038/ng1517.
Borck G, Wunram H, Steiert A, Volk AE, Korber F, Roters S, Herkenrath P, Wollnik B, Morris-Rosendahl DJ, Kubisch C: A homozygous RAB3GAP2 mutation causes Warburg Micro syndrome. Hum Genet. 2011, 129 (1): 45-50. 10.1007/s00439-010-0896-2.
Bem D, Yoshimura S, Nunes-Bastos R, Bond FC, Kurian MA, Rahman F, Handley MT, Hadzhiev Y, Masood I, Straatman-Iwanowska AA, Cullinane AR, McNeill A, Pasha SS, Kirby GA, Foster K, Ahmed Z, Morton JE, Williams D, Graham JM, Dobyns WB, Burglen L, Ainsworth JR, Gissen P, Muller F, Maher ER, Barr FA, Aligianis IA: Loss-of-function mutations in RAB18 cause Warburg micro syndrome. Am J Hum Genet. 2011, 88 (4): 499-507. 10.1016/j.ajhg.2011.03.012.
Liegel R, Handley M, Ronchetti A, Brown S, Langemeyer L, Linford A, Chang B, Morris-Rosendahl D, Carpanini S, Posmyk R, Harthill V, Sheridan E, Abdel-Salam GMH, Terhal PA, Faravelli F, Accorsi P, Giordano L, Pinelli L, Hartmann B, Ebert AD, Barr FA, Aligianis IA, Sidjanin DJ: Loss-of-function mutations in TBC1D20 cause cataracts and male infertility in blind sterile mice and Warburg micro syndrome in humans. Am J Hum Genet. 2013, 93: 1-14. 10.1016/j.ajhg.2013.10.011.
Ainsworth JR, Morton JE, Good P, Woods CG, George ND, Shield JP, Bradbury J, Henderson MJ, Chhina J: Micro syndrome in Muslim Pakistan children. Ophthalmology. 2001, 108 (3): 491-497. 10.1016/S0161-6420(00)00540-6.
Derbent M, Agras PI, Gedik S, Oto S, Alehan F, Saatci U: Congenital cataract, microphthalmia, hypoplasia of corpus callosum and hypogenitalism: report and review of Micro syndrome. Am J Med Genet A. 2004, 128A (3): 232-234. 10.1002/ajmg.a.30109.
Morris-Rosendahl DJ, Segel R, Born AP, Conrad C, Loeys B, Brooks SS, Muller L, Zeschnigk C, Botti C, Rabinowitz R, Uyanik G, Crocq MA, Kraus U, Degen I, Faes F: New RAB3GAP1 mutations in patients with Warburg Micro Syndrome from different ethnic backgrounds and a possible founder effect in the Danish. Eur J Hum Genet. 2010, 18 (10): 1100-1106. 10.1038/ejhg.2010.79.
Graham JM, Hennekam R, Dobyns WB, Roeder E, Busch D: MICRO syndrome: an entity distinct from COFS syndrome. Am J Med Genet A. 2004, 128A (3): 235-245. 10.1002/ajmg.a.30060.
Abdel-Salam GM, Hassan NA, Kayed HF, Aligianis IA: Phenotypic variability in Micro syndrome: report of new cases. Genet Couns. 2007, 18 (4): 423-435.
Varnum DS: Blind-sterile: a new mutation on chromosome 2 of the house mouse. J Hered. 1983, 74 (3): 206-207.
Spence SE, Gilbert DJ, Harris BS, Davisson MT, Copeland NG, Jenkins NA: Genetic localization of Hao-1, blind-sterile (bs), and Emv-13 on mouse chromosome 2. Genomics. 1992, 12 (2): 403-404. 10.1016/0888-7543(92)90392-6.
Fouquet JP, Valentin A, Kann ML: Perinuclear cytoskeleton of acrosome-less spermatids in the blind sterile mutant mouse. Tissue Cell. 1992, 24 (5): 655-665. 10.1016/0040-8166(92)90036-7.
Sotomayor RE, Handel MA: Failure of acrosome assembly in a male sterile mouse mutant. Biol Reprod. 1986, 34 (1): 171-182. 10.1095/biolreprod34.1.171.
Sakane A, Manabe S, Ishizaki H, Tanaka-Okamoto M, Kiyokage E, Toida K, Yoshida T, Miyoshi J, Kamiya H, Takai Y, Sasaki T: Rab3 GTPase-activating protein regulates synaptic transmission and plasticity through the inactivation of Rab3. Proc Natl Acad Sci U S A. 2006, 103 (26): 10029-10034. 10.1073/pnas.0600304103.
Carpanini SM, McKie L, Thomson D, Wright AK, Gordon SL, Roche SL, Handley MT, Morrison H, Brownstein D, Wishart TM, Cousin MA, Gillingwater TH, Aligianis IA, Jackson IJ: A novel mouse model of Warburg Micro syndrome reveals roles for RAB18 in eye development and organisation of the neuronal cytoskeleton. Dis Model Mech. 2014, 7 (6): 711-722. 10.1242/dmm.015222.
Haas AK, Yoshimura S, Stephens DJ, Preisinger C, Fuchs E, Barr FA: Analysis of GTPase-activating proteins: Rab1 and Rab43 are key Rabs required to maintain a functional Golgi complex in human cells. J Cell Sci. 2007, 120 (Pt 17): 2997-3010. 10.1242/jcs.014225.
Sklan EH, Serrano RL, Einav S, Pfeffer SR, Lambright DG, Glenn JS: TBC1D20 is a Rab1 GTPase-activating protein that mediates hepatitis C virus replication. J Biol Chem. 2007, 282 (50): 36354-36361. 10.1074/jbc.M705221200.
Pereira LA, Tanaka H, Nagata Y, Sawada K, Mori H, Chimelli LM, Nishimune Y: Characterization and expression of a stage specific antigen by monoclonal antibody TRA 54 in testicular germ cells. Int J Androl. 1998, 21 (1): 34-40. 10.1046/j.1365-2605.1998.00086.x.
Cheng FP, Fazeli A, Voorhout WF, Marks A, Bevers MM, Colenbrander B: Use of peanut agglutinin to assess the acrosomal status and the zona pellucida-induced acrosome reaction in stallion spermatozoa. J Androl. 1996, 17 (6): 674-682.
Liegel R, Chang B, Dubielzig R, Sidjanin DJ: Blind sterile 2 (bs2), a hypomorphic mutation in Agps, results in cataracts and male sterility in mice. Mol Genet Metab. 2011, 103 (1): 51-59. 10.1016/j.ymgme.2011.02.002.
Li Q, Pene V, Krishnamurthy S, Cha H, Liang TJ: Hepatitis C virus infection activates an innate pathway involving IKK-alpha in lipogenesis and viral assembly. Nat Med. 2013, 19 (6): 722-729. 10.1038/nm.3190.
Acknowledgements
This work was supported by National Institutes of Health grants EY018872, P30EY001931 (D.J.S.), Research Training Program in Vision Science EY014537 (R.P.L.) and Dr. Michael J. Dunn Summer Medical Student Research Fellowship Award, Medical College of Wisconsin (A.K.P).
Author information
Authors and Affiliations
Corresponding author
Additional information
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
AKP and RPL designed and performed the experiments, analyzed the data and wrote the manuscript. AR carried out genotyping and overall assisted with experiments. AG carried out ZFN design. ADE analyzed the brains. AKP and RPL wrote the manuscript. DJS conceived the idea, designed the experiment and supervised the analysis and the writing of the manuscript. All authors read and approved the final version of the manuscript.
Authors’ original submitted files for images
Below are the links to the authors’ original submitted files for images.
Rights and permissions
Open Access  This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made.
The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder.
To view a copy of this licence, visit https://creativecommons.org/licenses/by/4.0/.
The Creative Commons Public Domain Dedication waiver (https://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.
About this article
Cite this article
Park, A.K., Liegel, R.P., Ronchetti, A. et al. Targeted disruption of Tbc1d20with zinc-finger nucleases causes cataracts and testicular abnormalities in mice. BMC Genet 15, 135 (2014). https://doi.org/10.1186/s12863-014-0135-2
Received:
Accepted:
Published:
DOI: https://doi.org/10.1186/s12863-014-0135-2