Skip to main content

Table 5 Primers used for real-time quantitative PCR

From: Fatty acid biosynthesis and transcriptional regulation of Stearoyl-CoA Desaturase 1 (SCD1) in buffalo milk

Target genes Primer Sequences(5′~ 3′) Tm (°C) GenBank Accession No.
SCD1 F: TCCTGTTGTTGTGCTTCATCC
R: GGCATAACGGAATAAGGTGGC
59 AY241933
FAS F: GCAAAGTGGTCATTCAGGTACG
R: CCCAGTGATGATGTAGCTCTTG
60 KM980092.1
PPARG F: CAGTGTCTGCAAGGACCTCA
R: GTAAAAGGCATGGGAGTGAT
59 HG270143.1
SREBP1 F: CTGACGACCGTGAAAACAGA
R: AGACGGCAGATTTATTCAACTT
58 KU517672.1
GPAT F: GCAGGTTTATCCAGTATGGCATT
R: GGACTGATATCTTCCTGATCATCTTG
59 AY515690.1
AGPAT6 F: AAGCAAGTTGCCCATCCTCA
R: AAACTGTGGCTCCAATTTCGA
59 DY208485
ACACA F: TCCTGCTGCTATCGCTACTCCA
R: CGCACTCACATAACCAACCAT
61 DQ773054.1
GAPDH F: TGGAAAGGCCATCACCATCT
R:CCCACTTGATGTTGGCAG
60 NM001034034.1