Skip to main content

Table 5 Primers for others

From: Cloning and expression analysis of GATA1 gene in Carassius auratus red var

Primer name Sequence (5′ → 3′) Application
β-actin -F GGCCTCCCTGTCTATCTTCC qRT-PCR
β-actin -R TTGAGAGGTTTGGGTTGGTC  
GATA1-F4 TTTATTTCGTTGGAGGAGATC methylation sequence obtaining
GATA1-R4 CGCTATCTAAAATACTTTCCACG