Skip to main content

Table 4 Primers for 5′unknown sequences

From: Cloning and expression analysis of GATA1 gene in Carassius auratus red var

Primer name Sequence (5′ → 3′) Application
GATA1-SP1 CAGAGCAAGGCTGTGGAAGTCATTT 5′- Walking PCR amplification
GATA1-SP2 GTCCTGGTTTGGAGGTTGTTTGCC  
GATA1-SP3 GCTTCCACCTTTGATAGAGGCTGA  
GATA1-F3 ATGGCTGTAGTGCTCATTCATCGCT verification
GATA1-R3 CAAGAGATTCACAACTATGACTGCG