Skip to main content

Table 4 LRRTM4 Primers and probes for genotype or expression analyses

From: Identification and validation of quantitative trait loci for ascites syndrome in broiler chickens using whole genome resequencing

ID Sequence
F1 CAGCCACTGATGCAATGAGCTGTCTGAA
R1 CTCGGTASTAGCTGAAGCACGCACATC
P1 HEX-TGAAATCTATTACCTGCATCATCTGCCT
P2 FAM-TAAGATCTATTACCTGCATCATCTGCCT
F2 GCCCTGCACGTATACCATCT
R2 CGACTGAGTTCCAGGTTGGT
  1. Oligonucleotide IDs designate primers as forward (F), reverse (R), or probe (P). P1 was the reference allele, with P2 as the non-reference allele. Bases in BOLD are the SNPs assayed
\