Skip to main content

Table 1 Primers used in this study

From: Cloning, characterization of TaGS3 and identification of allelic variation associated with kernel traits in wheat (Triticum aestivum L.)

PrimerSequence (5′-3′)explanationpredicted PCR product Size
TaGS3-4A-FCGATCCTTCTCTGCGGCAAGprimers for amplifying TaGS3-4A2435 bp
TaGS3-4A-RCCTACAGACCGACGACTTCCTG  
TaGS3-7A-FCGACTTCCTGTCTCCTTCCGGprimers for amplifying TaGS3-7A2389 bp
TaGS3-7A-RTCATGCCCGTCAAAAACACCAG  
TaGS3-7D-FGACGACTTCCTGTCTCCTACTTCCprimers for amplifying TaGS3-7D2409 bp
TaGS3-7D-RTCATGCCCGTCAAAAACACCAG  
TaGS3-7A-1907-F1FAM-GCGCCGGTTGCTCCTCATCTTGCGKASP marker for distinguishing A/G allele 
TaGS3-7A-1907-F2HEX-GCGCCGGTTGCTCCTCATCTTGCA  
TaGS3-7A-1907-CRAGGGACGCCRCCGCAGCACACGGT