Skip to main content

Table 1 PCR primers used for the amplification of DAB sequences in Rhodeus sinensis. Data comprise primer name, direction (D), sequence, priming position (Position) and reference (Ref)

From: Polymorphism of MHC class IIB in an acheilognathid species, Rhodeus sinensis shaped by historical selection and recombination

Name D Sequence (5′ - 3′) Position Ref
FishIIBEx2-1F F CTGATGCTGTCTGCTTTCACTGGA SP 1
FIBE-F1 F CTGATGCTGTCTGCTTTCAC SP P
ROSI-R1 R CGGGATCCCAGTCTACGATG TM P
ROSI-R2 R GATCCCAGTCTACGATGATG TM P
ROSI-R3 R GAGTGTATTCTAGGTGAGAGTGG exon3 3′ end P
ROSI-R4 R CAGGTGCGAGTGAATCTGGT exon3 middle P
ROSI-R5 R CTGAGCTTGACCTTTGGTGC exon3 5′ end P
Rooc-Fw F CCCATAGTTGACATGATGTCATCTG intron1 2
Rooc-Rev R CATGTGTGACAGGAGGATCAG intron2 2
DAB1-Rev374 R CAAGAGTTTCCCGTGTGACAG intron2 2
DAB1-Fw18 F AGTTGACATGATGCCATCTGA intron1 2
DAB-Ex1-Fw F CATCCATACTGATGCTGTCTGC SP 2
Rhod-GSP2 R CCAGTCTCCGTTAGGCATCTCC exon3 2
SP-F1 F CTGATGCTGTCKRCWTTYACYGGA SP P
TM-R1 R TGGTACCAGGATCCTCCC TM P
TM-R2 R TGGKACCAGGATYCTCCC TM P
MHC2-TMr R TCAGTTTGGTACCAGGATCCTCC TM P
Exon-3R R TGAGCTTGACCTCTGGTGCCAC exon3 5′ end P
THMHCI-3R R GCCAGCGTGATCCACCATAC TM P
  1. (Ref) 1: Ottová et al., 2007 [41]; 2: Agbali et al., 2010 [33]; P: present study
\