Skip to main content

Table 3 Primers information

From: Preliminary study on microR-148a and microR-10a in dermal papilla cells of Hu sheep

Genes References sequences Sequences (5′ → 3′) Product length (bp)
Smad1 AY035385 F: GAAAGCCCCGTTCTTCCTCC
R: GTTGGGCTGCTGGAAAGAAT
150
Smad2 AY185300.1 F: GCAGGAATTGAGCCACAGAG
R: GCTGCAAATCCAAGCTCTGA
172
Smad3 AF508024.1 F: GGACGACTACAGCCATTCCA
R: ATTCGGGGAGAGGTTTGGAG
172
Smad4 NM_001267886 F:CTTCAGGTGGCTGGTCGG
R:TCCAGGTGATACAACTCGTTCA
177
Smad5 AF508027 F:CCAGTATATCCAGCAGAGATGTT
R:AAGCTTCCCCAACACGATTG
102
Smad6 XM_004010255.3 F: CTGCTCGGACGCCTCTTC
R: GGGTGGCGGTGATTCTGG
105
TGF-β1 NM_001009400 F:GGTGGAATACGGCAACAAAATC
R:TGCTGCTCCACTTTTAACTTGA
162
GAPDH NM_001190390.1 F: GTCGGAGTGAACGGATTTGG
R: CATTGATGACGAGCTTCCCG
196
\