Skip to main content

Table 1 Detailed information of 24 indels of 11 genes identified in Chinese Holstein cattle

From: Determination of genetic associations between indels in 11 candidate genes and milk composition traits in Chinese Holstein population

Indel Gene Location GenBank no. Position in UMD_3.1 Indel Sequence Confirmed?
1 N ins FCGR2B exon7 rs381714237 chr3:7930047 G 1
3 N ins CENPE exon58 ss2137349053 chr6:23018080 AGA 1
3 N del CENPE exon68 chr6:23026632–23026634 TAG 3
3 N ins CENPE intron13 rs385060942 chr6:22983076 GTT 1
1 N ins CENPE intron13 ss2137349051 chr6:22983397 T 1
1 N del CENPE intron18 rs384082187 chr6:22989805 A 2
21 N ins CENPE intron24 rs377812754 chr6:22996564–22996573 ACTTAAGTATATAACCTTAAC 2
2 N del CENPE intron41 rs453960300 chr6:23018994–23018995 CC 1
1 N del CENPE intron49 rs378415122 chr6:23036105 C 1
4 N ins CENPE intron51 ss2137349056 chr6:23040582 ACAC 4
2 N del RETSAT 3’UTR rs136527375 chr11:49489416–49489417 AA 2
9 N ins RETSAT intron6 rs134985825 chr11:49485899 ATTCTGGGG 1
1 N ins ACSBG2 intron7 rs377943075 chr7:19476990 G 1
2 N ins NFKB2 5′ regulatory region chr26:22891203 GG 3
1 N del TBC1D1 intron1 rs136639319 chr6:58898979 T 1
1 N ins NLK intron1 rs137724510 chr19:20180649 T 2
2 N del NLK intron1 rs379188781 chr19:20189055–20189056 AT 1
1 N del NLK intron3 rs135129224 chr19:20264835 A 2
4 N del NLK intron3 rs134444531 chr19:20276109–20276112 AAAA 1
5 N del MAP3K1 intron16 ss2137349058 chr20:22365627–22365631 CATTT 1
6 N del SLC30A2 intron2 ss2137349049 chr2:127640012–127640017 TTTTTG 2
2 N ins ANGPT1 intron1 ss2137349057 chr14:59305051 AT 2
1 N ins UGDH intron7 rs383327605 chr6:60236955 T 2
1 N ins UGDH intron2 ss2019489562 chr6:60252782 G 1
  1. Note: 1 indels were genotyped successfully; 2 indels were failed to genotype using MALDI-TOF MS; 3 indels were not polymorphic in current population; 4 primers of indel were failed to design