Skip to main content

Table 1 Gene-specific primers used in current study

From: Genetic control of anthocyanin pigmentation of potato tissues

Gene GenBank ID Purpose Annealing temperature (°C) Forward primer (FP, 5′ → 3′) Reverse primer (RP, 5′ → 3′) Primer binding site
FP RP
StAN1 KM822778
AY841130
AY841128
KM822780
diagnostic PCR, sequencing 55 GGAAGGACAGCTAACGATG AGTGTTCTTTCAGCTTCTCC E3 E3
  chr10:51745200–51,749,200 PCR, sequencing 50 GTCACATCACTACACCACAT TCCACTTCATCCCAATCAAAG promoter E2
  AY841128 full length CDS amplification, sequencing 50 ATGACTTCACATGTAATGATCAT CTAATTAAGTAGATTCCATATATCA E1 E3
  AY841128 qRT-PCR (a) 60 GGAGAAGGAAAGTGGCATCTTGTTCCA TCCACTTCATCCCAATCAAAG E1 E2
  AY841128 qRT-PCR (b) 60 GAGAAGCTGAAAGAACACTACCT CACCATCACCTTGTCCTTGT E3 E3
StMYBA1 JQ219855 qRT-PCR 60 GTGGTCACTTATTGCTGGTAGA GGCGAGGAGGAGGAGTAATA E3 E3
StMYB113 KU242748 qRT-PCR 60 CTAGGCAACAGATGGTCACTTAT CTTCCTGTGTAGGTGTGTGTT E3 E3
StbHLH1 JX848660 qRT-PCR 60 CCACCAAAGCCAGCTTTATC ATCCGCTGGACAAATACCAG E5 E5
StJAF13 KP317176 qRT-PCR 60 CTGCAGAGCAGACATCTGATAA GCAGCTTTCAGGTTCCATTTC E7 E7
StWD40 JX848661 qRT-PCR 60 ACCCTTAAGCCTGTTCCAAATC CACCGGAAGAGGCAAGAATATC E1 E1
\