Skip to main content

Table 1 Gene-specific primers used in current study

From: Genetic control of anthocyanin pigmentation of potato tissues

Gene GenBank ID Purpose Annealing temperature (°C) Forward primer (FP, 5′ → 3′) Reverse primer (RP, 5′ → 3′) Primer binding site
StAN1 KM822778
  chr10:51745200–51,749,200 PCR, sequencing 50 GTCACATCACTACACCACAT TCCACTTCATCCCAATCAAAG promoter E2
  AY841128 full length CDS amplification, sequencing 50 ATGACTTCACATGTAATGATCAT CTAATTAAGTAGATTCCATATATCA E1 E3