Skip to main content

Table 4 Raw and permutation P values of the F-d/BC-associated haplotypes in the CFA26 candidate region at 32226403-33034398 bp

From: A genome-wide association study identifies candidate loci associated to syringomyelia secondary to Chiari-like malformation in Cavalier King Charles Spaniels

Name Haplotype Frequency Raw P value Corrected P value
1 TTCCCGACAGACGGTAATTGTGTTATAATGTTA 0.215 0.00237 0.01067
2 CCGTAAGTAAGAAGGCAGCGCGTCTCGAAACCG 0.492 0.903 1
3 TTCCAAGTAAGAAGGCAGCGCGTCTCGAAACCG 0.0538 0.562 0.998
4 TTCCCGACAGACGGTAATTGTGTTTCGAAACCG 0.0308 0.434 0.9865
5 CTCTAAGTGAACAATAGGCATACTTCGGAGCTG 0.108 0.000584 0.00231
6 CTGTCAATGAACAGTAGGCATACTTCGGAGCTG 0.0231 0.0584 0.3657
7 CCGTAAGTAAGCAATAGGCATACTTCGGAGCTG 0.0154 0.724 1
8 TTCCCGACAGACGGTAATTGTACTTCGGAGCTG 0.0154 0.301 0.9372