Skip to main content

Table 2 Primers for site-directed mutagenesis

From: Regulatory single nucleotide polymorphisms (rSNPs) at the promoters 1A and 1B of the human APC gene

SNP Mutagenic oligonucleotide primer 5’- > 3’
rs115658307: C > T Forward:GGAGGGTAAGTAGCAAGGGGGCGG
Reverse:GCTACTTACCCTCCGCCATCTTGTGGG
rs138386816: C > T Forward:GGCCGCTGGAAGCCTAGCCGCTGCT
Reverse:GCTTCCAGCGGCCACACCCCGCCC
rs79896135: C > G Forward:GCTGCTGGGGGGGGACCTGCGGGCT
Reverse:CCCCCCCAGCAGCGGCTAGGCTTCC
rs78429131:T > G Forward:AAGCACGCAGTTGCCTTCTCGGGC
Reverse:CAACTGCGTGCTTCACCTTCCTCA
rs75612255: T > C Forward:CTCTCCCCCCCACCTCCGGCAT
Reverse:AGGTGGGGGGGAGAGTAATAAATTA
rs113017087: T > C Forward:GCTGGACGCGGACCAGGGCGCTCCCC
Reverse:GTCCGCGTCCAGCGGATTACACAGC
  1. Note: The points of site-direct mutagenesis is marked in italic
\