Skip to main content

Table 1 Cotton phytochrome and HY5-specific CAPS and dCAPS markers

From: Development, genetic mapping and QTL association of cotton PHYA, PHYB, and HY5-specific CAPS and dCAPS markers

# CAPS markers Primer sequences (5’–3’) PCR products (bp) Restriction enzyme Restriction products (bp)
G. hirsutum (‘TM-1’) G. barbadense (‘Pima 3-79’)
1. PHYA1_CAPS F-5’TGCAAAGCAGGAACTTGGCA
R-5’CATCCATTTGATAGTCCTTCCAC 3’
122 Mbo I
Dpn II
51/71 122
2. PHYB_dCAPS F-5’CAACCTCAAAATCTGATGAAGTAAAC3’
R-5’CTATCAAAACTCAGAACTGCTAAAGC3’
149 Alu I 149 125/149
3. GhHY5-2_dCAPS F-5’AACTATATCTGGGAATTACCGATT3’
R-5’GTTTCGCAACAACCTCTTTTCA3’
97 Hinf I 27/70 97