Skip to main content

Table 1 Primers used to amplify the ENG gene

From: Mutational and clinical analysis of the ENG gene in patients with pulmonary arterial hypertension

EXON PRIMERS SIZE
Forward 5’ → 3’ Reverse 5’ → 3’
1 ACTGGACACAGGATAAGGCCCAGC AATACTTGGGGCCTGGTCCGTG 180 bp 62 °C
2 CACCTTATTCTCACCTGGCCTCTT CTGCCTTGGAGCTTCCTCTGAG 249 bp 61 °C
3 GGGTGGCACAACCTATACAAAT CAGAGATGGACAGTAGGGACCT 269 bp 60 °C
4 CTACATGGGATAGAGAGGGCAC TTCCTCCTGAGCAGTATCATGAG 277 bp 55 °C
5 TGAGGGAAGGGACTGAGGTGC GTGGGGACTAGTGTCAGGGGC 238 bp 63 °C
6 GGCCTGTCCGCTTCAGTGTT GTTTTGTGTCCCGGGAGCTG 203 bp 58 °C
7 CCCCCTGTTCTGCCTCTCTC CTGATCCAAGGGAGGGGAAG 256 bp 63 °C
8 ACACATATCACACAGTGACCAGC CTAGGGGAGGAACCAGATGTC 253 bp 55 °C
9 CTCCTGATGGTGCCCCTCTCTTC TTGTCTTGTGTTCTGAGCCCCTG 296 bp 60 °C
10 CTGCAGGGGCTCAGAACACA GGCCAGGTGGGTTAGCACG 212 bp 61 °C
11 ATTGACCAAGTCTCCCTCCC GAAAGGCGGAGAGGAAGTTC 211 bp 61 °C
12 GGTGGGGTGAAGAGCAGCTG GACCTGGAAGCTCCCACTTGAA 359 bp 58 °C
13 GAGTAAACCTGGAAGCCGC GCCACTAGAACAAACCCGAG 154 bp 55 °C
14 A CCAGCACAACAGGGTAGGGGAT CTCAGAGGCTTCACTGGGCTCC 255 bp 61 °C
14 B AGGACCCTGACCTCCGCC CTCTCCTGCTGGGCGAGC 198 bp 63 °C