Skip to main content

Table 3 Potential novel miRNAs with miRNA* found in S. italica

From: Combined small RNA and degradome sequencing to identify miRNAs and their targets in response to drought in foxtail millet

miRNA Mature Sequence Arm Length (nt) miRNA* sequence percursor location MFE
sit_novel_miR10 GTATGGAAGAACTGCTGCGCCA 3p 22 ATGGTGTACCGGTTGTTATGC scaffold_7:35210708..35210784:- -30.2
sit_novel_miR15 CACTATAGGAGCTGGCCAGGT 5p 21 AGGCTAGGCTTGCGACTGGAG scaffold_14:67096..67179:- -31.4
sit_novel_miR30 TTAGGCTCGGGGACTATGGTG 5p 21 CCGTAGCCCCTGCTCCTGATG scaffold_5:4967704..4967886:- -101.4
sit_novel_miR41 GTGCTCCCTCCCGTTGTCACC 3p 21 TGACAACGAGAGAGAGCA scaffold_8:21627028..21627140:+ -71.2
sit_novel_miR42 TGAGCCGAACCAATATCACTC 3p 21 CGTGGTGTTGTTTCGGCTCATG scaffold_1:34236041..34236153:+ -53.1
sit_novel_miR45 GGATATTGGTGCGGTTCAATC 5p 21 TTGAGCCGTGCCAATATCACG scaffold_7:30396911..30397013:- -50.3
sit_novel_miR48 TGGTAGGCATTCTGGTTAAGT 3p 21 TTAGCCAAGAATGACTTGCCTATC scaffold_3:6158117..6158229:+ -49.2
sit_novel_miR56 TTGACAGAAGAGAGCGAGCAC 5p 21 GCTCGCTCCTCTTTCTGTCAGC scaffold_4:31435223..31435323:+ -66.6