Skip to main content

Table 2 The primer forward and reverse sequences, amplicon sizes of promoter upstream the coding region

From: Promoter polymorphisms in genes involved in porcine myogenesis influence their transcriptional activity

Gene SNP position accession number/locus forward sequence reverse sequence amplicon size (bp)
MYOD1 G302A U12574 TAGGCTACTACGGG ATCCCAGCGGGGGCGG 257
GDF8 A447G-A879T AY527152 GCCCTCTGGTCAAATGAGAA GATTTTAAAATCAATAC 1139