Skip to main content

Table 2 Examples of different types of microsatelitte repeat structures identified in Peronosclerospora sorghi – pathotype. 3

From: Simple sequence repeat markers useful for sorghum downy mildew (Peronosclerospora sorghi) and related species

Microsatelitte loci Type Repeat structures
DM2 simple and perfect repeat GT GT GT GT GT GT GT GT
DM16 simple and Imperfect repeat TG TG TG TG TG TG TG TG TG TA TG TG TG TG TG TG TG TG TG TG TG TG TG TG TG TG TG TG TG TG TG TG
DM13 compound and imperfect CACACACACACACACATCTG TATATATA
  1. Bold and underlined are interrupted non repeat nucleotides makes the SSR loci imperfect
\