Skip to main content

Table 2 Primer sequences.

From: A single point-mutation within the melanophilin gene causes the lavender plumage colour dilution phenotype in the chicken

Name Position Direction Sequence 5'-3'
ML5'-1 5'-UTR Forward GACTGCCCGTGGCCCCATTATTTG
ML1F 5'-UTR Forward GCTTTAAGACCGGTTGGATCTAC
SJ93 Exon 1 Forward GGGGAGGAAGCTGGATCTCTC
RACE4F Exon1 Forward ATGGGGAGGAAGCTGGATCTCTCCAAG
RACE2R Exon 1 Reverse ACCTCCCAGACATGCTTGGCCTCCTC
RFLP-F1 Intron 1 Reverse ACACTGACACAGCTGATAACATCAC
MV2R Exon 2 Forward GAAGTGCAAGATAGACCAGGAAAG
RACE1R Exon 2 Reverse GCTTGCTGTTCAGCAGGAACTTGAAGG
MV18F Exon 3 Forward GAAGGGGAATTCAGCTCTTCTAGG
ML14F Exon 5–6 Forward CAGAGTGCTACAGCAGAATGC
BlotE91F Exon 8–9 Forward CTCGGGAAGTCAGATTCATGAGC
ML3R Exon 10 Reverse CTTTCTCTTCAACTCCTCCTCCTC
ML16F Exon 12 Forward GTCTACCTGACTGCTGGGAAGG
RACE5F Exon 15 Forward GCCACAGGTCCTCAGGAGGAGGTTC
MV8R Exon 16 Forward ATGACTCCTTTGACCGCAACTC
MV6F Exon 17 Reverse AGGACAGGTGGGTCATCACTG
ML15R Exon 17 Reverse CTCAGGACAGGTGGGTCATCACTG
ML3'-1 3'-UTR Reverse GATGAGGCAGGGTGGCAGGACCAG
  1. Only base pair position 103, causing the R35W substitution, was shared by all the lavender phenotypes studied and those that were expected to be heterozygous at this locus.
\