Skip to main content

Table 1 Detail information for MR1-MR5 of the chicken PIT1 gene

From: The PIT1 gene polymorphisms were associated with chicken growth traits

Markers Source1 Variation Region Primers (forward/reverse) (5' → 3') Size (bp)2 Enzyme
MR1 Nie et al. 2005 57 bp indel Intron 2 PR1 (gtcaaggcaaatattctgtacc/tgcatgttaatttggctctg) 387 or 330 /
MR2 Rs13905611 C/T Intron 5 PR2 (ggaccctctctaacagctctc/gggaagaatacagggaaagg) 599 TaqI
MR3 Rs13687125 A/G Intron 5 PR2 (as described above) 599 MspI
MR4 Rs13687127 C/T Intron 5 PR3 (ggggattttgccactttaggg/tgggtaaggctctggcactgt) 442 EcoRI
MR5 Rs13687128 C/T Exon 6 (I syn) PR4 (tgggaagaacagtttatggc/tggctagcttgtaagggaatc) 483 TasI
  1. 1 MR1 was reported by Nie et al. (2005); MR2-MR5 were released by NCBI with accession number of Rs13905611, Rs13687125 Rs13687127, and Rs13687128, respectively. The chromosomal sites for MR1-MR5 were nt 96213503–96213559, nt 96221521, nt 96221553, nt 96222619, and nt 96224228, respectively. 2 indicated length of PCR products