Skip to main content

Table 3A Primers designed to screen the coding sequence of ENaC α, β, and γ genes. Optimum temperatures (°C) for PCR and DHPLC are included in the table.

From: Sequence analysis of coding and 3' and 5' flanking regions of the epithelial sodium channel α, β, and γ genes in Dahl S versus R rats

   Sequence PCR DHPLC
ENaC α     
Exon 1 Forward GGTAGCACGGAGCTGGAG 64 63
  Reverse CCCAGGCTGAGTTCACTCTC   
  Forward AGCTCAATACTGCTTGGTTGG 61 63
  Reverse GAAGAGCTCCCGGTAGGAG   
  Forward GGGACAAACGTGAAGAGCAG 61 63
  Reverse CTTGCTTTTGTGCTGCTGAG   
Exon 2 Forward CACTGATCCCCTCCGTGTTA 60 64
  Reverse TCCATCAGGCCTCTATCTGAA   
Exon 3 Forward GCTCTCTGTCCCTCACCTTG 63 62
  Reverse ACCACCAAGCATTTCCTGAG   
Exon 4 Forward CACATTGGAGGTGACAGGAA 63 61
  Reverse CCAAGGTGAGACCCAGAAGA   
Exon 5 Forward GCTGGCCTTGTTCTATCAGG 62 62
  Reverse CTCCCTTCAGTCTCCTGCTG   
Exon 6 Forward GGTGAAGCCTGAGTCATTCC 63 62
  Reverse CCAACCTACTTCCCCTCCAT   
Exon 7 Forward GAGGGATGGAGGGGAAGTAG 61 61
  Reverse AGCCAGCACCTAGGGAAAA   
Exon 8 Forward GGCACCATTGAAATGCTCTT 59 61
  Reverse ATCAAAGTGCCCAGTTACGG   
Exon 9 Forward GCAGCTGCTTAACCTGGTAGA 61 61
  Reverse ATGTCCACTTGTGCGTGTGT   
Exon 10 Forward CCATCCCTGTAAACATGAGG 61 61
  Reverse CCCCAATATCTCCACCAGAA   
Exon 11 Forward TGGTGGAGATATTGGGGAGA 61 61
  Reverse CAAACCCTTCTGACCCTTCA   
Exon 12 Forward TGACAGGAGGCGCTAGAGT 62 63
  Reverse AGTAGCATAGGCAGGTGGAG   
  Forward CTCCACTCCAGCTTCCTCCT 62 63
  Reverse ATCGTTAGCCCCTGTCCTCT   
  Forward TCTCACTTCAGCACATCTTCC 61 63
  Reverse GGCCTACCCTGGTCTGTCTT   
  Forward ACCCAAAAGCCCCCTTGT 61 61
  Reverse AGTACACTGTGGGGGTGAGG   
  Forward CCAAAGGCACCATTTCTTTT 59 61
  Reverse ATGTAGGCGGTGCCTCAG   
ENaC β     
Exon 2 Forward CTAGTCTCCAGGCCCATGAC 62 64
  Reverse CTACTGGAAGGGGCTGGAAT   
Exon 3 Forward CCCCATGTTCCACACTCTTT 60 62
  Reverse AACAAAAATCGATTGCTACCAG   
Exon 4 Forward TAATACGGTGCTGCCATTCC 61 63
  Reverse GCATAGATCAGCCTGTGTGC   
Exon 5 Forward CTCCAGCAGAGCAGGACAAT 62 61
  Reverse GGTCTTTCCGCCCTGTGT   
Exon 6 Forward GGTGATGGCCTCCCTTCTAT 61 61.5
  Reverse AGGCAGCCTGAACACAAGAG   
Exon 7 Forward GCTCCATGGGGAGGTACATA 63 63
  Reverse GTCCGGCCCTCATAGGTAAG   
Exon 8 Forward AAAGTCTCTGGGCTCCAAGG 63 61.5
  Reverse AGAGGCCCCCTTGCCTAAC   
Exon 9 Forward GAGGGAAGACCCCTGGAAG 62 63.5
  Reverse ATACTGGGTGTCGCTGGAAG   
Exon 10 Forward TCCTGCAAGTGAGTGTGTCC 62 63
  Reverse AGGGGGAGAAGACCCTCTTT   
Exon 11 Forward AGCATGTGTGTGCGTGTGTA 60 63
  Reverse CAGCAAGAGCAGTTTGGACA   
Exon 12 Forward CAACTCAGACTGGAGATGAGCA 62 62.5
  Reverse GGAACCATAACCCCCACCTA   
Exon 13 Forward CCTAGGTGGGGGTTATGGTT 62 64
  Reverse GCAGCCTCAGGGAGTCATAG   
  Forward CTTCCAGCCTGACACAACC 62 63.5
  Reverse GCCTGTCTGCTAGGTCAACA   
  Forward CTGAGGGGTTCATAGGGTCA 62 60.5
  Reverse ATCCTACACCCCAGACATGC   
ENaC γ     
Exon 2 Forward AGTCGCAGGCTCCAGAGAT 62 64
  Reverse GAGGGGCTTTGACATCCAT   
Exon 3 Forward GGAAGGCAACATGAAGAAGC 61 60
  Reverse ACTGTGAGCCCACCAGCTC   
Exon 4 Forward AAGGACCTACCCTGGCATCT 63 60
  Reverse CTCAAGGCCTACAGGTGAGC   
Exon 5 Forward ACGCAATGCTTCCTGACTTC 60 60
  Reverse TGCACTGCTGCTGTCAAGAT   
Exon 6 Forward CCCTGGGGACTGCTTTTT 60 60
  Reverse TCCATTAGCAGCACCTCCTT   
Exon 7 Forward AGGGGAATCCTCCTATCTGG 61 62
  Reverse CCTTGGCCTAGATATAGCTTCA   
Exon 8 Forward AGGGAGTTCCCGGTCTCTAC 63 61
  Reverse GCGTGGCCAAGCTGATTC   
Exon 9 Forward AGATGGTGGAGGTTCCACAG 63 60
  Reverse GGGAGAAAGGCACAGAGTGA   
Exon 10 Forward ACTGGGGCAGGTAGGACTTT 62 60
  Reverse GCTTTGGCTGTGTTGCTGTA   
Exon 11 Forward CCAAAGCCAGAGACAGGTTG 59 61
  Reverse TCGAATGAACGAAAAGGTGA   
Exon 12 Forward ACCTGGCAGGAAGCCAAG 62 61
  Reverse CCCTCTGGCAGCAAAACTAC   
Exon 13 Forward CCCTGAGTGCAGGATTTATCA 61 64
  Reverse GTATCTGGGAGGTGGTGTGC   
  Forward GTCAGTGGCACAAAGCCAAG 62 64
  Reverse AGCTCATAAGTGCCAAGTCCA   
  Forward CCTGCTGTGAACCGGATA 60 60
  Reverse GGCCAACTGTCTGTCTGAGG   
  Forward GCCAGCTATTGCCTGACAT 60 60
  Reverse CGCATACTCTCAGTTCAAAGACA   
  Forward GCCAAATGGTATTCCCACAA 59 57
  Reverse ATTGGACTAGCCTGGGTGCT