Skip to main content

Table 1 Construction of gene knockout and complementation plasmids.

From: Essential and non-essential DNA replication genes in the model halophilic Archaeon, Halobacterium sp. NRC-1

Plasmid name Primer position Primer Sequence 5'-3' Number of 5' codons Number of 3' codons
pBBΔorc1 5' forward CGCAAGCTTGACTCCACCCTTCCGAGAGT 3 2
  5' reverse CGCACTAGTGGTGATCATGGGTTTGCGTC   
  3' forward CGCACTAGTCGAAACTAGCTCTCCAAGCTC   
  3' reverse CGCGGATCCTCTACTGTACAGCAGATGAG   
pBBΔorc2 5' forward CGCAAGCTTCAACAAAATTATGCGTAGAG 2 3
  5' reverse CGCACTAGTCGTCATTGAATATCACACGG   
  3' forward CGCACTAGTGCCACGTTCTGAGTATTCTG   
  3' reverse CGCGGATCCGATCTTGTACTTGTCCTCGC   
pBBΔorc3 5' forward CGCGGATCCTGAAACGGGTCTGTGAGTGG 4 6
  5' reverse CGCACTAGTCCCTTTCACCATCTCGATAA   
  3' forward CGCACTAGTCAGACGTTGATGGGATGGTGA   
  3' reverse CGCGAATTCGGTGAGGACCTCGAGTTCGAT   
pBBΔorc4 5' forward CGCAAGCTTCAGGAGACAGCTACCTACGA 3 2
  5' reverse CGCACTAGTGGGCGTCATTGAATATCACA   
  3' forward CGCACTAGTCGCGAGTAATGACCCCTACT   
  3' reverse CGCGGATCCTCGGCTATCAAGGGTTCAGC   
pBBΔorc5 5' forward CGCAAGCTTAGTTGGTGACGCTCATCGGC 4 2
  5' reverse CGCGAATTCGCGACCAGCCATACGTATGC   
  3' forward CGCGAATTCGAGGAGTAGTTGCCAGGCGA   
  3' reverse CGCGGATCCTGATCGAGGCGAACACGCTG   
pBBΔorc6 5' forward CCGGAATTCTTCGAGGCGACGCTGCGGGA 7 6
  5' reverse CTCTTCGGGGTCCTCATCCAT   
  3' forward GCGGTCCTGGAGCGCCTGTAG   
  3' reverse CCGGAATTCCAGCGCCTCAACCCGATCGAC   
pBBΔorc7 5' forward CGCGGATCCGCGCCCGAACGCAACTAGAA 3 3
  5' reverse GCGCTCGAGGTCTGTCATGTATTCACGCAC   
  3' forward GCGCTCGAGGAGAACAATTAGTGGATGCT   
  3' reverse GCGAAGCTTGGTGTGATGTTCATGACCAT   
pBBΔorc8 5' forward CCGGAATTCCACGTCGTGTTGGCGGTGGT 3 3
  5' reverse GCGCTCGAGCGTCTTCATCGCTTGCCGAGA   
  3' forward GCGCTCGAGGCGACCGTGTAGACCCCGGA   
  3' reverse CGCAAGCTTGATGAAGCTCCGCCGCAGCG   
pBBΔorc9 5' forward CGCAAGCTTTGGGTCGTGTACACGGCCTC 4 3
  5' reverse CGCACTAGTGCGGCAGGTCATATAAGAGT   
  3' forward CGCACTAGTGTAACCCAATAAGCTGCGAA   
  3' reverse CGCGGATCCAACACTCATCGACGAGTGAA   
pBBΔorc10 5' forward CCGGATCCCCTGTGGTCGTTCTGGAAGAC 5 2
  5' reverse CCACTAGTACCCAACAGTGACATCCTCC   
  3' forward CGCACTAGTGTGCTGTAGCGATTGTGCGA   
  3' reverse CGCCTCGAGCACGGAGACGTCGAGAGCGAG   
pBBΔpolD1 5' forward CCGGAATTCGTCGGTCGGATCGGGGACAT 2 2
  5' reverse GCGCTCGAGCGTCATGTCCCCGTCGATCT   
  3' forward GCGCTCGAGTTCTCGTAGCCACGGCGGCG   
  3' reverse GCGAAGCTTCGTTGTGCACCATCGTCACC   
pBBΔpolD2 5' forward GCGGAATTCGGCGTGGCGGTAACGGCGTT 1 2
  5' reverse GCGACTAGTCATTACAGCCAGCGGTCGAG   
  3' forward GCGACTAGTTTCATGTGACCACGGCGCTC   
  3' reverse GCGAAGCTTGACGTGATCGACGAACACACC   
pBBΔpolB1 5' forward CCGGAATTCGCCAACACTGCCGCGTTGAA 3 3
  5' reverse CGCACTAGTGTTTCCCATTGGGTTCGGGT   
  3' forward CGCACTAGTCAGTTCACGTAGCCCGCTGG   
  3' reverse CGCAAGCTTCTCGTCAACAACGCCGGGCT   
pBBΔpolB2 5' forward CGCGAATTCCCGAACGACGCGGCATCAAG 2 2
  5' reverse CGCACTAGTCGGCATTCCCTACAGAACCA   
  3' forward CGCACTAGTCTGTCGTAGTGGACCCCACC   
  3' reverse CGCAAGCTTCGGCTTTTCCTGGCCAAGTC   
pBBΔmcm 5' forward CGCGAATTCGTCGAGAACCCCAGGATGAG 3 3
  5' reverse CGCACTAGTCGGATCCATCTGGTAGAGAT   
  3' forward CGCACTAGTCGCTCGATCTAGCCGACGGC   
  3' reverse CGCAAGCTTACAGCACGCCCACGTGCTCGT   
pBBΔpri1 5' forward ATGAGTCCCCCACTCGGTCTT 2 6
  5' reverse GTGCATGCCGGCAATCGTGG   
  3' forward GCCGAGAAGGCCACAGAATGA   
  3' reverse GGCGGCTCTTCGACCTGACT   
pBBΔpri2 5' forward TCTGTCAGGACCGGGCCACT 2 2
  5' reverse GTTCATGCTGGCCCGTGTTTG   
  3' forward CCCGATTAGCCCTGCTTGCC   
  3' reverse ATGGCTAACTCCAACGCCAA   
pBBΔpcn 5' forward TCTCGTCTGCGGCGGGGGTA 4 4
  5' reverse CGCCTTGAACATTATTGCAGA   
  3' forward ATCCAGTCCAACTGACGCCA   
  3' reverse ATGCTGGCCCGTGTTTGCGA   
pBBΔrad2 5' forward CCGGAATTCGTGATGTCGAACACGGGGAA 3 2
  5' reverse CGCCTCGAGGTTCCCCATCACGCCCAGTT   
  3' forward CGCCTCGAGTGGACGTGACCGGCGCTGAT   
  3' reverse CGCAAGCTTGCGTAAAAGCCATCGGAACC   
pBBpolD1 all 5' forward CGCGAATTCCATACCGGTTCGGTCGTACC   
  3' reverse CGCACTAGTCAGGAAGTCCTCTCGCATAC   
pBBpolB1 all 5' forward CGCGAATTCGTCACCTCGGTCCGTGGTAG   
  3' reverse CGCACTAGTGCGTTCGCGGCGACCCAGAGT   
pBBmcm all 5' forward CGCGAATTCGAACAGCATGAACATGCCGA   
  3' reverse CGCACTAGTCGAATACGCCACTGCTAACAA   
pBBpri2 all 5' forward CGCGAATTCGGCGTACTTCCACGTCCAGGG   
  3' reverse CGCACTAGTGCCACGTCCGGGTACGCAGTG   
pBBrad2 all 5' forward CGCGAATTCCCAGCACGAGTCGAGTGGTAA   
  3' reverse CGCACTAGTATCCATGCCTGTGCGTGAGC