Skip to main content

Table 1 Polymorphic microsatellite markers that were screened on a panel of captive tigers (n = 21)

From: Genotyping faecal samples of Bengal tiger Panthera tigris tigris for population estimation: A pilot study

Locus Primer Sequence (5'-3') Repeat Type Tm k Ho He PIC
D15 D15F: 5' TGTGACCTTTCTCTAGTTTC
D15R: 5' GCACAAAACATTCAGTCTCC
(CA)22, simple 51 8 0.381 0.740 0.689
3E6 3E6F: 5' CCTGGGGATAATAAAACTAGTA
2E6R: 5'CATGAATGAATCTTTACACTGA
(TAA)11, simple 56 5 0.571 0.684 0.606
E21B E21F: 5' GCGATAAAGGCTGGCAGAGG
E21BR: 5' CTTTGAGGGTCTGTTCTACTGTGA
(CA)21, simple 61 5 0.667 0.718 0.657
D10 D10F: 5' CCCTCTCTGTCCCTCCCTTG
D10R: 5' GCCGTTTCCCTCATGCTACA
(GT)14, simple 63 5 0.524 0.812 0.759
E7 E7F: 5'GCCCCAAAGCCCTAAAATAA
E7R: 5'GCATGTCGGACAGTAAAGCA
(CA)11CG(CA)4, interrupted 55 7 0.571 0.662 0.600
C34 C34F: 5'CTCCACACTGAGCATGGAAA
C34R: 5'CAACCAAAGGCAGGAACAGT
(CT)21, simple 55 8 0.250 0.805 0.756
6HDZ003 Williamson et al (2002)   55 8 0.350 0.782 0.729
Fca304 Menotti-Raymond et al, 1999, Luo S-J et al, 2004   55 8 0.476 0.753 0.701
Fca43 Menotti-Raymond et al, 1999, Luo S-J et al, 2004   55 6 0.524 0.769 0.714
Fca139 Menotti-Raymond et al, 1999, Luo S-J et al, 2004   55 4 0.167 0.678 0.600
  1. Tm = Annealing temperature; k = number of alleles; He = Expected heterozygosity; Ho = Observed Heterozygosity; PIC = Polymorphism Information Content