Skip to main content

Table 4 Primer sequences for the amplification of canine CLCN3 exons

From: Characterization of the canine CLCN3 gene and evaluation as candidate for late-onset NCL

Forward primer Sequence (5' – 3') Reverse primer Sequence (5' – 3') TM(°C) Product size (bp)
CLCN3_Ex1_F AGCAGGGGTGGAAGAAATG CLCN3_Ex1_R AACTACAGAACCGCCCAGC 60 233
CLCN3_Ex2_F ACCTAGTTCACCATTGTCTCTCA CLCN3_Ex2_R TATTTTGGCTGCCAGAGGTC 60 312
CLCN3_Ex3_F ACCCCTTGCTCTCAAATCCT CLCN3_Ex3_R TTGTAGGGTGAAGGAGAGAACT 60 418
CLCN3_Ex4_F GTCTCAACACTCCAAAAGTGGAC CLCN3_Ex4_R CTGTAATTAAACGGAGACTCATCTCA 60 321
CLCN3_Ex5_F TGTGGAAGTAAGCCAAGAAACTC CLCN3_Ex5_R CTCCCCCTAAAGGCAAAAAG 60 318
CLCN3_Ex6_F AAGTGTTCCTGTTTCCTGAATGA CLCN3_Ex6_R GACTGAGCAGTACTGGGGATG 60 459
CLCN3_Ex7_F TTGGAAAGAGGTAGCCATCG CLCN3_Ex7_R GGCTTTTCTCAAGGTAAAGAACAT 60 936
CLCN3_Ex8_F GCTGCAGCAAAAATTAGACCA CLCN3_Ex8_R AAATGGAACCCAAAAGATAAGAA 60 781
CLCN3_Ex9_F AGTTTTATTTGTACTAGGATTTTGCTC CLCN3_Ex9_R CAATAGCAGTACTGTTTCATTTCTGTG 60 474
CLCN3_Ex10_F TCCTGTCCTCCTTGACCAAT CLCN3_Ex10_R CCCCCAGAAACCCAACTAAT 60 579
CLCN3_Ex11_F GGGACCAAATTCATGGGATA CLCN3_Ex11_R TGTTTTGGCAAAGATGTGGT 60 511
CLCN3_Ex12_F GGACCTGGGATTTCGAACC CLCN3_Ex12_R TTATTCAGCAGGCATCTGGG 60 343
CLCN3_Ex13_F ATCAAAGGATGGTTGCTGGA CLCN3_Ex13_R TTGCGATGTCGGAGTAACAG 60 647