Skip to main content

Table 3 Primer sequences for the amplification of canine CLCN3 cDNA

From: Characterization of the canine CLCN3 gene and evaluation as candidate for late-onset NCL

Primer Sequence (5' – 3') Localization within canine CLCN3 TM(°C)
5' RACE outer primer TGTACGAGCCAGGACCTTCT exon 4/exon 5 junction 60
5' RACE inner primer TTTGTCATTTCCCATGCTGA exon 2 60
3' RACE outer primer TGCTTTAGTGGCTGCATTTG exon 8 60
3' RACE inner primer TGACTGTCTCCCTGGTGGTT exon 10 60
CLCN3_F1 ATGGATGCTGCTTCTGATCC exon 1 60
CLCN3_R10 CAGCAGCCAGAGTGGTATGA exon 10 60