Primer name | F/R* | Nucleotide sequence (5' → 3') | Position | Function |
---|---|---|---|---|
mo-21s | F1–3 | GGTGAGAGAAGGAGGGTGAG | intron 1 | amplification-sequencing of intron 2 for all alleles |
mo-31r | R1,4 | CCAGCACCCCGGCCAGCA | intron 3 | amplification-sequencing of intron 2 /screening of 46G>A |
ABO-46A-F | F4 | CCAGGAAAACCAAAATGCCACA | exon 2 | screening of 46G>A |
ABO-106G-R | R2 | TAGACTTCTGGGGCTTAGGAC | exon 3 | amplification of O 2 allele in intron 2 |
ABO-106T-R | R3 | AGACTTCTGGGGCTTAGGAAC | exon 3 | amplification of new hybrid allele in intron 2 |
ABO-inII-123F | F | GTTATCAGGGTCCTAAGGACAG | intron 2 | sequencing of intron 2 |
ABO-inII-660R | R | CTGCCTGTTGGTCCCTTCCTC | intron 2 | sequencing of intron 2 |
ABO-133s | F5–8 | GCCCCAGAAGTCTAATGCCAG | exon 3 | amplification-sequencing of introns 3 and 4 |
ABO-202 cons-R | R5 | GGGAGGCACTGACATTATACC | intron 4/exon 4 | amplification-sequencing of intron 3 (except O 2 , B and hybrid alleles**) |
ABO-188A-R | R6,9 | ATACCTTGGCAACGAGACGT | intron 4/exon 4 | amplification-sequencing of hybrid allele in intron 3 and screening |
ABO-220 T-R | R7,10 | CCACGGTGTCAGCACCTTTGA | exon 5 | amplification-sequencing of O 2 allele in introns 3 and 4 |
ABO-220 C-R | R8,11 | CACGGTGTCAGCACCTTTGG | exon 5 | amplification-sequencing of B allele in introns 3 and 4 |
ABO-inIII-F | F9 | GCTGGCCGTTACAGGGTCTG | intron 3 | screening of 188G>A mutation in exon 4 |
ABO-inIII-425F | F | GCTGCCCTCATCTCTGTGACA | intron 3 | sequencing of intron 3 |
ABO-inIII-672F | F | GTGCTATGGCCTCTGTTGGG | intron 3 | sequencing of intron 3 |
ABO-inIII 916F | F | CTCTGGCAGTTGATGCTGGC | intron 3 | sequencing of intron 3 |
mo-41s | F10,11 | TAAATCCTGCTCCTAGACTAAAC | intron 3 | amplification-sequencing of intron 4 |
ABO-inIV 170F | F | GACTTGGCCCTCGTCCTGCA | intron 4 | sequencing of intron 4 |
ABO-inIV-429R | R | GACTAGCCTGGCCAACATGG | intron 4 | sequencing of intron 4 |
ABO-inIV-852F | F | TAGCAACTCCATTTTCCCTCCC | intron 4 | sequencing of intron 4 |
ABO-inIV 877R | R | GTTGGAGTAGCAGACTCATAACA | intron 4 | sequencing of intron 4 |
ABO-inIV 1122F | F | CTCCTGAGCCTCTACAATCCT | intron 4 | sequencing of intron 4 |
ABO-inIV 1411F | F | CTCTACGTCCCTCCCAGCCT | intron 4 | sequencing of intron 4 |
ABO-229F | F12,13 | CTACCCCCAGCCAAAGGTGC | exon 5 | amplification-sequencing of all alleles in intron 5 |
ABO-297A-R | R12 | GTTGAGGATGTCGATGTTGAAT | exon 6 | amplification-sequencing of A 1 , A 2, O 1 and hybrid allele in intron 5 |
ABO-297G-R | R13 | GTTGAGGATGTCGATGTTGAAC | exon 6 | amplification-sequencing of B, O 1vand O 2 alleles in intron 5 |
mo-101s | F4,9 | CCGTCCGCCTGCCTTGCAG | intron 6 | internal control primer pair in screening |
EPB-79R | R4,9 | TACTTGTTCAGGTGGCTCTCGTC | exon 7 | internal control primer pair in screening |