Skip to main content

Table 4 Primer sequences used in qPCR for SCNN1 gene family members and internal control gene β-actin

From: The sodium channel gene family is specifically expressed in hen uterus and associated with eggshell quality traits

Primer name Sequence (5’→3’) Tm(°C) Product size (bp) Position
SCNN1a-F TCATGTTCAGCGCCATCCT 60 175 Exon3+4 628-802
SCNN1a-R TTCCCGCACTGCATCCA 60  
SCNN1b-F GAAGTTCCCAGCAGTCACAGTCT 60 168 Exon2+3 277-444
SCNN1b-R GTGGCGTTGCTGTTGTTCAG 60  
SCNN1d-F CACCATCCACGGCACCAT 60 183 Exon1 90-272
SCNN1d-R AACATCTTGGGCTCCGAATG 60  
SCNN1g-F TGGGACAAAGGACAGAAAATC 60 141 Exon10+12 1450-1590
SCNN1g-R GCCGAAGTTGGACAGAAGGA 60  
β-actin-F TATGTGCAAGGCCGGTTTC 60 110 Exon1+2 113-222
β-actin-R TGTCTTTCTGGCCCATACCAA 60