Skip to main content

Table 6 Details of microsatellite loci genotyped in H. erato and H. melpomene.

From: Comparative population genetics of mimetic Heliconius butterflies in an endangered habitat; Brazil's Atlantic Forest

     Ta(oC)  
Locus Primer sequence (5'-3') Core repeat GenBank number H. erato H. melpomene Ref.
Hel02 F: TCAAAATGTTGCAGACCGAG (GA)13(GAAA)2(GA)2 AF481467 55 - [59]
  R: TGCACTTCATTGTAAGGCGT      
Hel05 F: TGCTGTCCATACCCAACTCA (GA)14CA(GA)4 AF481470 52 55 [59]
  R: CGAACTCACAACCATCAGTCA      
Hel10 F: TCTCACTTTCCCACACAGCA (CA)7TA(CA)10 AF481475 55 - [59]
  R: TGTGAAGAGACACATGGGGA      
Hel11 F: TTTCTTTTGAGTCCCGATGG (CA)12 AF481476 55 55 [59]
  R: ATCTCAGAACTGGTCGGCAG      
Hel12 F: CGGCACTTCATGTTTCATTT (TAG)4 AF481477 55 - [59]
  R: GGCATTTGACTTCAGAATGG      
Hel13 F: ATTTCATAGTAACGCCCTCC (CA)13 AF481478 55 - [59]
  R: TGACTTATCGCTAAGGTCAA      
Hm06 F: AAATAGTGTGCGGCGGAATA (CA)7 DQ020077 55 - [60]
  R: TGGAGTAGAAATGCGGGTTTA      
Hm08 F: AAAGCCTGAGTGCCGTATTG (CA)17 DQ020079 - 55 [60]
  R: GCAATGTCAGCATCGAATGT      
Hm16 F: CGGATAGACATTTGTTAAAGTGTG (CA)14 DQ020086 - 55 [60]
  R: ACGAGGATGCGGACTACG      
Hm22 F: CCTCGTCCAAACTCCAAAAC (GA)16 DQ020090 - 52 [60]
  R: AACAATGTCACAACCATCGC