Skip to main content

Table 3 List of 1RS-specific ISBP markers

From: Investigation of genetic diversity and population structure of common wheat cultivars in northern China using DArT markers

Marker Left primer Right primer Annealing temp. (°C)
ora013 TGTTATATGAGCGCGAACCA GCAGAAGTTGGGCGTGTACT 62
ora014 AACTCCGAATCGTTGGGATA CCGTCGTCCCAAAATAGTGT 62
ora015 GCCGTCGTCTTCCTGAATAG ACCAAGATGAGCACCAAACC 62
ora016 TCCGTCCCCGTCTCCGTC ATAAGCCGTGCAAGTCGCC 62
ora017 TGACAAATTGGTTCGCAAGGGG GCAGCCGTCCACAGACATATAG 62