Skip to main content

Table 1 Bituminaria bituminosa simple sequence repeat (Bbit-SSR) primer pairs selected for characterisation of B. bituminosa germplasm

From: Next generation DNA sequencing technology delivers valuable genetic markers for the genomic orphan legume species, Bituminaria bituminosa

Marker name Forward primer sequence Reverse primer sequence
Bbit-SSR004 ACCACCCGCAGTTACTTTCACCT CCTTGTGCTGGTTTCACGCAACG
Bbit-SSR005 ACCAAGTCAGGCTGGAACCCCA GTCCTGGCCCACTGAACGCC
Bbit-SSR008 CATTGACATCCCTAAGCATAATGT TCGTTAATAGCGGTCTTGGG
Bbit-SSR010 GCAGGCTTTCCTGAACTGAC GTCTCCACCAGCAATACCGT
Bbit-SSR012 TCATCCCTTCTCTTCCTACTCG CGGTTTCTTCGAATACACAGTA
Bbit-SSR013 GAAGGCAAGTGAAAAGCCAG TCAGACACCAGTGGCTCAAC
Bbit-SSR015 GACTGCACGGTCTTCTCGAC ATGTGCAGAGGCATTTGTTG
Bbit-SSR034 CAATCCCATTTTCCGCTTTA TGCCCTCTTCCTTCATAGGTT
Bbit-SSR035 ATATCCACCACCTTCCGTGA GTAGGATAGGGTCCGGTGGT
Bbit-SSR040 TAACCACTTGGAACTGGGGT AATTGCAACAGCAGCAACAG
Bbit-SSR055 AGCATCACTACGACCATCCC GGTGACAACAGAGTGGTCTGA
Bbit-SSR056 TCATCCCTTCTCTTCCTACTCG CGGTTTCTTCGAATACACAGTA
Bbit-SSR059 CATTGACATCCCTAAGCATAATGT TCGTTAATAGCGGTCTTGGG
Bbit-SSR064 TTGCTTCTGCGTAACTGTGG AAAAGTCCACGTCAGCATCC
Bbit-SSR066 GGTCGTCCCATTTATCGAAG GGAAGAACGGTCAATGGAGA
Bbit-SSR067 TCACCTTCCTCACAAACTACCA TGAAATGCCTCAATGAGCTAAA
Bbit-SSR070 TGTCGAACTGTTGGATTGTGA AATTGCAACAGCAGCAACAG
Bbit-SSR073 TTTGCTTGTGTCCTGTCCAA CCTTCCCTTACCCACCAAGT
Bbit-SSR076 AGAAGGCAAGTGAAAAGCCA TCAGACACCAGTGGCTCAAC
Bbit-SSR079 GAGCTTCGGAGGGAGTTCTT CCAAAATCCATCACCTTCCA
Bbit-SSR090 CCCTAACATTGGTAACAGCCA GAGGCTGGCATCAAGTCAAC