Skip to main content

Table 1 Characteristics of SNPs discovered in IL10, IL10RA/B, TGFB1, and SLC11A1.

From: Polymorphisms in the gene encoding bovine interleukin-10 receptor alpha are associated with Mycobacterium avium ssp. paratuberculosis infection status

Gene SNP dbSNP ssID Region Mutation Primer set (5'-3')
IL10 -30A > C ss104807640 5'   F: GGTAAAGCAGTCCTGAATCCAA
      R: TCCTTCATGGGCCCTATTT
  -285T > C ss104807641 5'   F: AGCCAGCAGCTCTCAAAGTC
      R: GTGTTCAGTGTGGTCCTGGAT
IL10RA 633C > A ss104807642 Coding Syn F: TCGTGTTTATTGCTCTGGTTGT
      R: CCTGCTTCCTTCCCTCCT
  984G > Aa ss104807643 Coding Syn F: GGGTTCCTGCTGGTGACTC
      R: GCCAATGCCACTGTCCTC
  1098C > Ta ss104807644 Coding Syn F: GGGTTCCTGCTGGTGACTC
      R: GCCAATGCCACTGTCCTC
  1185C > T ss104807645 Coding Syn F: AGTGCAGACAGCGGGATCT
      R: TTCTTCAGGGGTCTGCAAAG
  1269T > Ca ss104807646 Coding Syn F: AGTGCAGACAGCGGGATCT
      R: TTCTTCAGGGGTCTGCAAAG
  1302A > Ga ss104807647 Coding Syn F: AGTGCAGACAGCGGGATCT
      R: TTCTTCAGGGGTCTGCAAAG
IL10RB 503C > Tb ss104807648 Coding Non F: GGGAATTCAGGGAATAAAGCA
      R: CTGTTTGGGGAATGCAGATT
  569A > Gb ss104807649 Coding Non F: GGGAATTCAGGGAATAAAGCA
      R: CTGTTTGGGGAATGCAGATT
TGFB1 258C > T ss104807650 Coding Syn F: CCCTTGCCAAACACTGACA
      R: CCTAGCCCAGGCCACTTT
SLC11A1 650C > T ss104807654 Coding Non F: TCCTCTGGAGAAGGGAAAGG
      R: ATTCAGAGGCAGGAGTCGAG
  1066C > G ss104807655 Coding Non F: ACATGTGTTGGCCAAGTGAA
      R: ACATCCGAGTCCTGAGTGGT
  1. Syn/Non, synonymous/non-synonymous; F/R, forward/reverse primers.
  2. a, b SNPs with common superscripts are tightly linked (Pearson's r ≥ 99%).