Skip to main content

Table 1 Primer sequences and amplification product sizes.

From: Monoallelic maternal expression of STAT5A affects embryonic survival in cattle

Primer Sequence Product size (bp) SNP (nucleotide number)1
5PSTAT5-3F
5PSTAT5-4R
CTGTAGTTGTCCCTGCAGAAG
CTGTGTCAGCCTCACCCTCTC
840 134357
5PSTAT5-5F
5PSTAT5-6R
GAGAGGGTGAGGCTGACACAG
CTGAGGCATGCAGACTCTTAG
921 134828; 134920; 135162; 135249; 135397
5PSTAT5-11F
5PSTAT5-12R
CACGGAGATACTTCCTGGAAGG
TGAACCGTGGCACACTCGTG
840 137887; 138012
5PSTAT5-13F
5PSTAT5-14R
CACGAGTGTGCCACGGTTCAG
CCAAACATCTGGCTGGGTTG
940 138242; 138299; 138337; 137338; 138596; 138653
SPSTAT3-21F
5PSTAT3-21R
CTTAAGAACTGGGGTTCCCGG
CTGCTCTCCTGAATATATGC
681 197390; 197429; 197456; 197558; 197602; 197608; 197713; 197718; 197740
STAT3F8
STAT3R8
TCCCCCAAGGATCCTACG
CCATAGTACCAGACAACTGG
420 171005
STAT3F12
STAT3R12
CACCCCCTGCATTGGAAGCG
CTTCTACTTGAGCATGTACAGGG
653 177338
STAT3F12A
STAT3R12A
CTCTCCTGCTCAGCTACATC
GGACTTTCAAAGAGACTCGG
469 177338
STATF1
STATR1
GAGAAGTTGGCGGAGATTATC
CCGTGTGTCCTCATCACCTG
820 153137
STAT14
STAT13
GAGGAGATGCTGGCTGAGGT
TTCAGGGGACAGGACTCTGG
440 153137
STAT14 (exon8)
STAT11 (exon 11)
GAGGAGATGCTGGCTGAGGT
CCGGTCAGCTCGCTTGATCC
360 153137
STAT3-1 (exon 13)
STAT3-2 (exon 9)
ACCGCATCTCTGCTCTCTCAG
GCCATTAGTCATCAAGACCG
253 177338
b-actin F
b-actin R
CAGCACAATGAAGATCAAGATCATC
AAAGGGTGTAACGCAGCTAACAGT
191  
  1. 1According to GenBank accession number NW_001493680