Skip to main content

Table 3 Primers for genomic DNA sequences

From: Cloning and expression analysis of GATA1 gene in Carassius auratus red var

Primer name Sequence (5′ → 3′) Product Length (bp)
GATA1-gDNA-F1 CAATCACCCACTATGCCAGAGC 914 bp
GATA1-gDNA-R1 GCTGAATAAAGAGGGCAGGCTG  
GATA1-gDNA-F2 TGGTCCACACTGAGGAGGGTTC 1238 bp
GATA1-gDNA-R2 GGAAACTGTGTACCAGGGACGG  
GATA1-gDNA-F3 CTGAGCCACTACAGTCCCTATG 1172 bp
GATA1-gDNA-R3 AGGGGTCTGTTCTGTCTATTCA  
GATA1-gDNA-F4 GATGGAACGGGACACTACCTCT 664 bp
GATA1-gDNA-R4 TAGAGTCCGCAAGCATTACACA  
GATA1-gDNA-F5 GGAACTCAATGTGTGAACTGTC 528 bp
GATA1-gDNA-R5 CTGTTCTTGCTGGACATCTTAC