Skip to main content

Table 2 Primers for full-length cDNA cloning and qRT-PCR

From: Cloning and expression analysis of GATA1 gene in Carassius auratus red var

Primer name Sequence (5′ → 3′) Application
GATA1-F1 GCTCCACAAAAGAAAGTCAT partial sequence obtaining
GATA1-R1 ACGAGGGTGTGTAGAGAAGT  
GATA1-F2 CCTCAATCACCCACTATGCC ORF qualifying
GATA1-R2 GTGGATTGAGATTCCGACAT  
GATA1-R-out GCTCTGGCATAGTGGGTGATTGAGGTTA 5′-Race PCR amplification
GATA1-R-in ATAATCGAAACACATCACTCACCCCA  
GATA1-F-out GGCGTCTACAGCCACTCATCCCATTCAC 3′-Race PCR amplification
GATA1-F-in GGATGCTTTAGTCACACGATGTCGGAAT  
GATA1-qF CCTTCCCTCCCTTATCCAG qRT-PCR amplification
GATA1-qR GGTAGTGTCCCGTTCCATC