Skip to main content

Table 2 Distances between two RNA ring sequences, RNA ring 13 and RNA ring 25, both with predicted anticodons matching amino acid glycine (underlined). D1 is the distance between these sequences, summing the number of positions where nucleotides differ. D2 indicates a distance that accounts for mutation bias for transitions (mutations within purines (A < ->G) and within pyrimidines (C < ->T)), a distance that is more realistic in an evolutionary context. Transitions among the two sequences are indicated in italics, and are counted as distance 0.5, resulting in D2 = 8.5

From: The primordial tRNA acceptor stem code from theoretical minimal RNA ring clusters

RNAAACDsD1 D2
13GATGGTACTGCCATTCAAGATGA11 8.5
25GATGGTGCCATTCAAGACTATGA