Skip to main content

Table 1 The 25 theoretical minimal RNA ring sequences. Columns are: 1) RNA ring numbering; 2) RNA ring cognate amino acid according to homology hypothesis with ancestral tRNAs [12]; 3) RNA ring with stop codon at 3′ extremity, anticodon underlined. Presumably, three consecutive translation rounds translated RNA rings, starting at the 3′ side of the stop codon

From: The primordial tRNA acceptor stem code from theoretical minimal RNA ring clusters

RNAAACDs
1FAATTCATGCCAGACTGGTATGA
2MCATGCCAGAAATTCTGGTATGA
3SATGGTGCCACTATTCAAGATGA
4PylATGCTATTCACCAAGATGGTGA
5VATGGTGCTACCATTCAAGATGA
6NATGGCCTATTCACAAGATGTGA
7DATGCCACTGGTATTCAAGATGA
8RATGTGGCCTACATTCAAGATGA
9SecATGCCAAGATGGTATTCACTGA
10LGCAATGTTTATGGAGACCATAA
11PTATGTTTGGAGACCAAGCATAA
12ETTCATGCCAGAAACTGGTATGA
13GATGGTACTGCCATTCAAGATGA
14IGCAGAATGTTTATGGACCATAA
15QAATATGTTTGGACCAAGCATAG
16LTATGTTTGGAAGCCAGACATAA
17KTACATTTGGAAGCCAGATGTAA
18SACAATGTTTATGGAAGCCATAG
19AATGGAAGCCATTTACAATGTAG
20WTACAGATGGAAGCCATTTGTAA
21CAACATGCCAGATTCTGGTATGA
22HTGCCAGAAACATTCTGGTATGA
23TTATGGTTCTGCAAGAACCATGA
24YTACCATTCTGCAAGAATGGTGA
25GATGGTGCCATTCAAGACTATGA