Skip to main content

Table 8 Characteristics of the palm SSR markers tested for transferability to B. aethiopum

From: Transferability, development of simple sequence repeat (SSR) markers and application to the analysis of genetic diversity and population structure of the African fan palm (Borassus aethiopum Mart.) in Benin

Marker name Primer sequences (5′-3′ orientation) Ta (°C) Source palm species Successful transfer to other palm species References
mEgCIR0230 CCCTGGCCCCGTTTTTC 57.0 E. guineensis E. oleifera
Syragus sp.
C. nucifera
P. roebelinii
P. canariensis
P. reclinata
[62]
AGCGCTATATGTGATTCTAA
mEgCIR0326 GCTAACCACAGGCAAAAACA 59.0
AAGCCGCACTAACATACACATC
mEgCIR0465 TCCCCCACGACCCATTC 63.1
GGCAGGAGAGGCAGCATTC
mEgCIR0476 TTCCTCGGCCCCTTCTC 61.6
TCGCCGACCTTCCACTG
EgCSSR-5781 TTCACGCTACTGATGGTTGG 59.4 E. guineensis B. flabellifer [49]
TCGATCCCTTCTCTGGAAAC
EgCSSR-1461 GTCCTCTCCTACGCCTCCTC 60.3
ATGCGATCCGAGTTCAGAAG
mEgCIR2332 GAAGAAGAGCAAAAGAGAAG 55.0 E. guineensis. B. flabellifer [44, 45]
GCTAGGTGAAAAATAAAGTT
mEgCIR3295 TGCCTCCAGACAATCAC 55.0
GTAAGGCTTAACCAGATAAC
mEgCIR3311 AATCCAAGTGGCCTACAG 55.0
CATGGCTTTGCTCAGTCA
mEgCIR3413 AAAGCTATGGGGTGAAAGAT 55.0
TGGATAAGGGCGAGAAGAGA
mEgCIR3477 CCTTCAAGCAAAGATACC 55.0
GGCACCAAACACAGTAA
mEgCIR3592 GAGCCAAAACAGACTTCAA 55.0
ACCGTATATGACCCCTCTC
mEgCIR3755 GCTCACCAAAAAGTGTTAAGTC 55.0
AGTTTCAACGGCAGGTATAT
mEgCIR3788 TTGTATGACCAAAGACAGC 55.0
AGCGCAACATCAGACTA
ESSR75 AGATGGTTGGAGATTTCATGGT 60.0 E. guineensis B. flabellifer [44, 45, 47]
AACTTGAGGGTGCCATTACAAG
ESSR76 CCATACCAGCAGAAGAGGATGT 60.0
CTGAAGGTCATAGGGGTCTCTG
ESSR82R CCCTCGACACCCATAGTTATTT 60.0
CTCGATTTCTGGCCTCTCATAC
ESSR332 AGTTAATGTGTCAGGGCCAGTT 60.0
CTTGGTTCACTTGGGTGTGTC
ESSR553 ATAAATTGTGCGAGGGGAAAAC 60.0
AGATCCGCGACAGGTCTTAAC
ESSR566 GTGTCATCAAATTCGGTCCTTT 60.0
CGGTTCTTCTGCTGCTCTACTT
ESSR609 AGGCGGTGATGAAGATGAAG 59.0
CTCCTCTCAAACAGAGTGGGAT
ESSR650 GCCTTTTCTGGTTAATGGACTG 59.0
GTTTGTCTATGGATGATTGTGAGG
ESSR652 CATACCGTCACCACTCAGAAAC 60.0
GCCGTCATTCTACCAGTTGAG
ESSR673 TTCTGGCTACGAGCATAAGGA 59.0
TCAATAACCCTGGCTAAACACA
ESSR681 TCTGAATTGTCGGAGTGGC 59.0
CATCCTTGCGTAAACAAAAGAG
CNZ34 CATGTCGATAATTATACCCAA 55.0 C. nucifera B. flabellifer
K.laciniosa
Z. zalacca
D.kurzianus
C.simplicifolia
C. mannan
C. thwaitesii
C. erectus
C. palustris
[46, 63]
TGCAAATATGAATGCAAACAC
CN2A5 AAGGTGAAATCTATGAACACA 53.2
GGCAGTAACACATTACACATG
CNZ 12 TAGCTTCCTGAGATAAGATGC 54.6 C. nucifera B. flabellifer
P. dactylifera
E. guineensis
[46, 64]
GATCATGGAACGAAAACATTA
CNZ 24 TCCTAAGCTCAATACTCACCA 55.0
CGCATTGATAAATACAAGCTT
CNZ 18 ATGGTTCAGCCCTTAATAAAC 60.3
GAACTTTGAAGCTCCCATCAT
CNZ 42 TGATACTCCTCTGTGATGCTT 55.5
GTAGATTGTGGGAGAGGAATG
CN2A4 CAGGATGGTTCAAGCCCTTAA 61.0
GGTGGAAGAGGGAGAGATTGA
CAC 21 AATTGTGTGACACGTAGCC 54.1 C. nucifera B. flabellifer [65, 66]
GCATAACTCTTTCATAAGGGA
CAC 71 ATAGCTCAAGTTGTTGCTAGG 54.2
ATATTGTCATGATTGAGCCTC
CAC 84 TTGGTTTTTGTATGGAACTCT 54.4
AAATGCTAACATCTCAACAGC
CN1H2 TTGATAGGAGAGCTTCATAAC 53.2 C. nucifera B. flabellifer
P. dactylifera
[65]
ATCTTCTTTAATGCTCGGAGT
PdAG-SSR TCTGATTTCGTTTACTTCTTAGGA 58.0 P. dactylifera   [44]
TTCATATTCAGTTGTCGGGTGTA
mPdCIR015 AGCTGGCTCCTCCCTTCTTA 59.1
GCTCGGTTGGACTTGTTCT
mPdCIR063 CTTTTATGTGGTCTGAGAGA 52.5
TCTCTGATCTTGGGTTCTGT
mPdIRD1 CTCGGAAGGGTATGGACAAA 59.6 P. dactylifera P. reclinata
P. roebelenii
P. rupicola
P. theophrasti
H. thebaica
L. carinensis
C. humilis
[67]
TTGCCTTCGACGTGGTAGTA
mPdIRD3 CATTGATCCAACACCACCAC 60.3
GCCAAAACCAGCTCTGGTAAC
mPdIRD4 TTGGTGGCCTTTCTCAGAGT 59.8
TGGGATCAAAGTAGGGTTGG
mPdIRD5 CTATCAGGATGGGGGTGATG 60.2
ACCCATCTGCATAGCTCCAG
mPdIRD7 TGCAATACGATGGCAGAGTC 60.2
CCTTGCAAGTTTTCCACACC
mPdIRD8 CTATTGGGTCCCTTGGTGAG 59.7
TGACTGCTCGTCATCAGGTC
mPdIRD10 ATGCGTTCATCTCCCTTGAG 59.7
GCTGCAAACATCATCCTCAC
mPdIRD11 GAGTTGGAGGCAAAACCAGA 59.8
CCACAAAACCCTTGTCTTCC
mPdIRD14 GAGGGGTTCACGTTTGTGTC 60.9
GCACCAAGCACAAGAGCAAT
mPdIRD15 CCGAGTCTGGCGAAGTAAAC 60.0
CTCCCCTTCCTCATCCTCTC
mPdIRD16 CTGTCCGATCGAATTCTGC 50.7
GGACATCTCTTTGCGGTCAT
mPdIRD17 GTGGGAGAAACCCGAAGAAT 60.2
CTGCTGCCTCATCTGCATT
mPdIRD20 TTGAATGGTCCCCTGTAGGT 59.5
GTCCCAGCATGATTGCAGTA
mPdIRD22 GGCTGTATGGGAAAGACCTG 59.5
CCTGCTGCATATTCTTCGTG
mPdIRD24 GCTCCTGCAGAACCTGAAAC 59.9
GGACATCACCGTCCAATTCT
mPdIRD25 CACTGGAAATTCAGGGCCTA 59.9
CCCAATTTCTCAGCCAAGAC
mPdIRD26 CCTCCAGTTCATGCTTCTCC 60.0
GAGCAGACCCGACAGACAAT
mPdIRD28 GAAACGGTATCGGGATGATG 59.7
TTAACGACGCCGTTTCCT
mPdIRD29 GGCTCCACCATCATTGACA 60.3
AACAGCATCGACTGCCTTCT
mPdIRD30 GCAGATGGTTGAAAGCTCCT 59.8
CCCCATTAACAGGATCAACG
mPdIRD31 GCAGGTGGACTGCAAAATCT 60.0
CTATTGGGGTGCTGATCCAT
mPdIRD32 AAGAAGACATTCCGGCTGGT 59.9
GCGGGTGTGTGATATTGATG
mPdIRD33 GGAGCATACAGTGGGTTTGC 60.1
CAGCCTGGGAATGAGGATAG
mPdIRD35 CAGCCCCTTACTCAGACTGG 59.6
CCCATAAGCTGATTGTGCTG
mPdIRD36 GACACGTTGACGATGTGGAA 60.7
CCATTGCTGTTGAGGAGGAG
mPdIRD37 TTTCCTGCTCGAAAGACACC 60.2
CTTAGCCAGCCTCCACACTC
mPdIRD40 GAGAGATGCGTCAGGGAATC 59.2
CCAGAATCTTCCAAGCAAGC
mPdIRD42 GAGGCAAAACTATGGGAAGC 59.5
TTCACTGGAGCAAGGGTAGG
mPdIRD43 GCAGCCATTGCTTACAGTGA 60.2
TAAACTGCTGCCTTCCTTGG
mPdIRD44 CAGATCCGGGAGATGATGAA 60.4
AGCAGGAGCAGCTGCATAA
mPdIRD45 TAGCCTGTGCATGTTCGTTG 60.4
AACAGCAGCTGATGGTGATG
mPdIRD46 ATGGGTCCATTGGAGGAACT 60.2
GACGGAGACCTTGACTGCTC
mPcCIR10 ACCCCGGACGTGAGGTG 62.8 P. dactylifera   Cherif, Castillo and Aberlenc-Bertossi, unpublished data.
CGTCGATCTCCTCCTTTGTCTC
mPcCIR20 GCACGAGAAGGCTTATAGT 51.7
CCCCTCATTAGGATTCTAC
mPcCIR32 CAAATCTTTGCCGTGAG 53.3
GGTGTGGAGTAATCATGTAGTAG
mPcCIR35 ACAAACGGCGATGGGATTAC 60.8
CCGCAGCTCACCTCTTCTAT
mPcCIR50 CTGCCATTTCTTCTGAC 50.6
CACCATGCACAAAAATG
mPcCIR57 AAGCAGCAGCCCTTCCGTAG 62.0
GTTCTCACTCGCCCAAAAATAC
mPcCIR85 GAGAGAGGGTGGTGTTATT 51.8
TTCATCCAGAACCACAGTA
mPdIRD41 ATCTTCCATGCAGCCTCAAG 60.3
CAGGTCGTCCCGTCTCTAAA
mPdIRD47 GTTGGCATCACTTCAGAGCA 60.1
GCTCTTTCGGTGCTAGTTGC
  1. For each marker, forward (top) and reverse primers (bottom) are provided
  2. Ta: average annealing temperature for each primer pair
  3. Species names are abbreviated as follows: P. roebelinii: Phoenix roebelinii; P. canariensis: Phoenix canariensis; Phoenix reclinata; H. thebaica: Hyphaene thebaica; L. carinensis: Livistona carinensis; C. humilis: Chamaerops humilis; K. laciniosa: Korthalsia laciniosa; Z. zalacca: Zalacca zalacca; D. kurzianus: Daemonorops kurzianus;C. simplicifolia: Calamus simplicifolia;C. mannan: Calamus mannan; C. thwaitesii: Calamus thwaitesii; C. erectus: Calamus erectus; C. palustris: Calamus palustris; P. rupicola: Phoenix rupicola; P. theophrasti: Phoenix theophrasti