Skip to main content

Table 2 List of selected primer pairs targeting putative B. aethiopum microsatellite loci and assessment of their polymorphism detection ability

From: Transferability, development of simple sequence repeat (SSR) markers and application to the analysis of genetic diversity and population structure of the African fan palm (Borassus aethiopum Mart.) in Benin

Locus name Repeat motif Primer sequences (5′-3′ orientation) Expected amplicon size (bp) Amplification product
MBo01 [AGG]7 CCTATCCTTCCATCCCGATCG 90 complex, polymorphic
TTGCCGTGAATCAGCCTCAA
MBo02 [ATC]7 GGGAGAACAAGGATAACAGCAG 115 single locus, monomorphic
TCCATTTCATCACTAGCTCGGT
MBo03 [AGG]7 CTCCGAGCCCTAGCAACTTT 131 single locus, monomorphic
TCTGGATGACGAAACCTTCACA
MBo04 [ACC]7 GATGTGGCCGCTCTGATCTC 192 single locus, monomorphic
ACATGCTGGCAAGGTATTCT
MBo05 [AAG]7 GTCCTAGCACGCTGGCATTA 202 single locus, monomorphic
TGGGTTGCCAATGAACCCTT
MBo06 [ATC]7 TGGCCATTCAACTGCTTCAC 202 single locus, monomorphic
GAATCTAGCACCAGCAAACCC
MBo07 [AAG]7 GGCACTGGAGTCCACATCAA 239 single locus, monomorphic
TCCTTCTGTACTGGCATCTCT
MBo08 [AGG]8 TGATTGTTTCCTCTTCCCTCCT 90 single locus, monomorphic
TTAATGAGCCGAAGAGGAGCC
MBo09 [AGG]8 TCCCTCACTCCCATCCTCTC 163 single locus, monomorphic
ACTCCACTCCTTCCCTCATACA
MBo10 [AAC]8 GTTAAAGACGCAGGGCTGGA 166 single locus, monomorphic
CCCACTTAGTGAGATAAGACTTGA
MBo11 [ATC]8 GCATCACATGGTTTCAGGCT 219 single locus, monomorphic
GCTCAACCATCGGCAGTGTA
MBo12 [ATC]9 GGAGGAAAGGTTGCCCTAGAA 102 single locus, monomorphic
TCTCAACCTGATGTCATTGCA
MBo13 [AAG]9 CAGGTTGCATCGGCCCATT 103 complex, polymorphic
GGAGCCTAATGCACCCAGAG
MBo14 [AAC]9 ATGGCCGATCCCACTTAGTG 117 single locus, monomorphic
GAGAGAACGGCAATAATTTATGCA
MBo15 [AAG]10 GCTGAAGAGGATGAAGAAGAAGC 92 complex, monomorphic
TCATCATCTCCCTCTCCTTCT
MBo16 [AGG]10 CAGCACTGGCCTCACAGC 118 single locus, monomorphic
CCGTCGATCAGTTGTTGGAGA
MBo17 [ATC]10 ACACAATGACCTTTCGCTGA 124 single locus, monomorphic
CCAAACAGGACCTTATGCCA
MBo18 [AAG]10 ACATCCTCTCCTTCATCTCCTT 187 complex, polymorphic
GTTCCTACAATGCTTGGCGC
MBo19 [AAG]10 TGCTATCACCCAATATCTAGGCT 202 single locus, monomorphic
ACAGTCAACAACTACCATACTGC
MBo20 [AAG]10 TGTGGTTAAAGCAATGGAAGCA 229 single locus, monomorphic
GCCGAACTCCTACTCTCATACG
MBo21 [AAG]11 ACAACAGAAGATCAGTATACGTTCT 171 single locus, monomorphic
TTGAGGAATCATGCTTGTCAGT
MBo22 [AAG]14 AGAAGAATTCGGTTAGGTCACAA 108 single locus, monomorphic
AGATAACATGGGTAAGAATTGCCT
MBo23 [AAT]5 TGAGTTCTTGTCTTGTCTTCGT 100 single locus, monomorphic
GGTTTGGGACACCCTTCAGG
MBo24 [AAT]9 AAAGTCATGTCTGGGTGATGAA 90 single locus, monomorphic
ATGATGAGCACAGCTACAACTCT
MBo25 [AAT]6 TCTTCAGGTGACAAGCAACA 96 single locus, monomorphic
CCTGGGCATGGAGATAGCAT
MBo26 [AAT]7 CCATAGGCCAGCCCACTATA 134 single locus, monomorphic
ACCCTTTCTTCTTCCTCATTTGT
MBo27 [AAT]7 TCTCTATTGCTTGGTGATCCC 103 single locus, monomorphic
TCCAACAAGGGATGGTTATCATG
MBo28 [AAT]8 GCCTTGAGAGTGGAAGAGGC 205 single locus, monomorphic
TCTCTTCTTTGCGCCCTCAT
MBo29 [AAT]16 AGACATGTAGAGGTGGGACT 211 single locus, monomorphic
TCTGTATGAGAGACGTGTTACAGT
MBo30 [AAT]8 TGACCATAACAAGCTACCAGGT 146 single locus, monomorphic
GGTGGAAGCTATTGATATTGCATGT
MBo31 [AAT]10 TGACAATGATGCATGCGATAACA 187 single locus, monomorphic
GCATCACCCATGTCCTTTAGC
MBo32 [AAT]10 TCCGAGGGCAGTATTTGTCG 117 single locus, monomorphic
CACTATTTCGGAAACCTAAGCCC
MBo33 [AAT]17 GCACACTTTGTATCCGACGC 147 single locus, monomorphic
CAGGGATAGTAACCGTCAGGG
MBo34* [AG]28 GTGGCACCTCTGCGGTTT 192 single locus, polymorphic
CGAGATGGAAGCACCTGGAG
MBo35* [AG]24 AGCATGCTTTCTGCTTCATGTG 137 single locus, polymorphic
CCTTTCCCTGACTGCATTGC
MBo36 [AG]23 TCGGAAGTCGAATGTGGCAG 180 no amplification
TCGGAAGAGTGGTCAATCATGG
MBo37 [AG]23 GCTCTACTCCCAGAGACGGA 142 complex, polymorphic
AACAGTCGACGGAATGCTCA
MBo38* [AG]20 AGTCCTCACTGCTGGTGGTA 130 single locus, polymorphic
TCCTTGAATAGTCCATCTTGCA
MBo39 [AG]19 AACGCAGGTTAAGAGGCTCC 168 complex, monomorphic
CCTCCTGGTGCAACCCTTAC
MBo40 [AG]19 TGTGGAGTGTGAGTCGATGG 193 complex, polymorphic
GGCTGCATAATCTCATCACGC
MBo41* [AG]18 TTCTCCACCAGCCTCACAAC 184 single locus, polymorphic
ATACGGCCCATCAACCCTTC
MBo42 [AG]18 CCTGGTGGTACATGTGGTCA 136 complex, polymorphic
TGTGGCACATTCATTTCTGAAGG
MBo43 [AG]18 AGTTTGTTCTGTGTGTTGTCAC 137 no amplification
GCACACATCTTGCTTTGAAGAC
MBo44 [AG]17 AACACACTTTAAATCGACTTCTTCA 193 complex, polymorphic
CACGGCTGCCATGTGAGG
MBo45 [AG]17 TAGATCGGAAGTCAGGCCC 193 no amplification
AGAGAAGTGGGAGGAGAGGTC
MBo46 [AG]17 GCCGATATTAGCTTCTTCTTGGC 154 single locus, monomorphic
GCCTTGTTGATCCCGTTTCAC
MBo47 [AG]16 GGCACCTGACGCCTCTTT 188 single locus, monomorphic
TCACTTCGACTCAATTGTATCCAT
MBo48 [AG]16 AGGACAAAGAGATGAGAAGCCT 92 complex, polymorphic
ACCAATTCCCAGTTAGTTGACCA
MBo49* [AG]16 CATCACCCATTCTCTCTGCCT 141 single locus, polymorphic
GAGAAACCATCCGCACCTCA
MBo50* [AG]15 AGAAGTCATCTTGAGGGCCC 150 single locus, polymorphic
TTGCTAGAATGATACACAAATTGCT
MBo51* [AG]15 TGTGCTATTTGTTGGGAATGCA 191 single locus, polymorphic
GCAAGCTCATGTTCTAGTTTCAAGT
MBo52* [AG]15 ACACATCCTACATGAATAGACCTCC 122 single locus, polymorphic
TCTTGTCATAGCCTAGATTCCCT
MBo53 [AG]15 AGGTTTAAGGGTTTGGGTTAGGG 131 single locus, monomorphic
GGTGGAGTAAGTTTGAGGGTCA
MBo54* [AG]11NNN[AG]15 CATATGCTGATACAAGAGAGAGGG 124 single locus, polymorphic
ACCTTATAAGCAGGATCCAGACA
MBo55 [AG]15 TGGAATCAACCTTGGGTCTACA 198 complex, polymorphic
TCGTCGGTCTTCTAGCCACT
MBo56* [AG]15 ACCAAGATCAAGCACGAGGA 103 single locus, polymorphic
AGGATCACCCTTTCTTTCTTTCT
MBo57* [AG]15 GGGTTCAATCCTGATGAGAGCA 136 single locus, polymorphic
ACCGTTCGATCAACCATGGT
  1. Loci for which single-locus SSR polymorphism has been detected within our test panel of seven B. aethiopum individuals are signaled by an asterisk (*)
  2. Conventionally, microsatellite motifs are displayed under the form [N1N2]x or [N1N2N3]x for dinucleotide and trinucleotide loci, respectively, where N1, N2 and N3 represent nucleotides included in the elementary unit of the motif and x is the number of unit repetitions. Expected amplicon size is as predicted by QDD