Skip to main content

Table 1 Summary of the designed primer sequences for gene expression analysis (F forward primer, R reverse primer)

From: Functional analysis of bovine interleukin-10 receptor alpha in response to Mycobacterium avium subsp. paratuberculosis lysate using CRISPR/Cas9

Gene Sequence Amplicon size (bp)
IL1A - F TTGGTGCACATGGCAAGTG 475
IL1A - R GCACAGTCAAGGCTATTTTTCCA  
IL1B - F GCCTTCAATAACTGTGGAACCAAT 100
IL1B -R GTATATTTCAGGCTTGGTGAAAGGA  
IL6 - F GGCTCCCATGATTGTGGTAGTT 523
IL6 -R GCCCAGTGGACAGGTTTCTG  
TNFA - F CGGTGGTGGGACTCGTATG 352
TNFA - R CTGGTTGTCTTCCAGCTTCACA  
SOCS3 - F GCCACTCTCCAACATCTCTGT 97
SOCS3 - R TCCAGGAACTCCCGAATGG  
IL10 - F AAAGCCATGAGTGAGTTTGACA 155
IL10 - R TGGATTGGATTTCAGAGGTCTT  
GAPDH - F TGGAAAGGCCATCACCATCT 60
GAPDH - R CCCACTTGATGTTGGCAG