Skip to main content

Table 5 Details of polymorphic SSR markers obtained from bulk segregant analysis detected in the QTL mapping

From: Genetic mapping of physiological traits associated with terminal stage drought tolerance in rice

Marker name Chrom# position Forward primer Reverse primer Repeat motif Annl temp
RM495 1 2.8 AATCCAAGGTGCAGAGATGG CAACGATGACGAACACAACC (CTG)7 55 °C
RM6703 1 139.1 CAGCAAACCAAACCAAGCC GCGAGGAGGAGGAGAAAAAG (TAC)12 55 °C
RM3825 1 143.7 AAAGCCCCCAAAAGCAGTAC GTGAAACTCTGGGGTGTTCG (GA)21 55 °C
RM327 2 72.6 CTACTCCTCTGTCCCTCCTCTC CCAGCTAGACACAATCGAGC (CAT)11(CTT)5 55 °C
RM341 2 94.4 CAAGAAACCTCAATCCGAGC CTCCTCCCGATCCCAATC (CTT)20 55 °C
RM263 2 127.5 CCCAGGCTAGCTCATGAACC GCTACGTTTGAGCTACCACG (CT)34 55 °C
RM22 3 7.2 GGTTTGGGAGCCCATAATCT CTGGGCTTCTTTCACTCGTC (GA)22 55 °C
RM517 3 30.3 GGCTTACTGGCTTCGATTTG CGTCTCCTTTGGTTAGTGCC (CT)15 55 °C
RM527 6 61.2 GGCTCGATCTAGAAAATCCG TTGCACAGGTTGCGATAGAG (GA)17 55 °C
RM3 6 92.4 ACACTGTAGCGGCCACTG CCTCCACTGCTCCACATCTT (GA)2GG(GA)25 55 °C
RM337 8 0.1 GTAGGAAAGGAAGGGCAGAG CGATAGATAGCTAGATGTGGCC (CTT)4–19-(CTT)8 55 °C
RM72 8 60.9 CCGGCGATAAAACAATGAG GCATCGGTCCTAACTAAGGG (TAT)5C(ATT)15 55 °C
RM316 9 1.8 CTAGTTGGGCATACGATGGC ACGCTTATATGTTACGTCAAC (GT)8-(TG)9 (TTTG)4 (TG)4 55 °C
RM257 9 79.7 CAGTTCCGAGCAAGAGTACTC GGATCGGACGTGGCATATG (CT)24 55 °C
RM271 10 59.4 TCAGATCTACAATTCCATCC TCGGTGAGACCTAGAGAGCC (GA)15 55 °C
RM171 10 92.8 AACGCGAGGACACGTACTTAC ACGAGATACGTACGCCTTTG (GATG)5 55 °C
RM484 10 102.9 TCTCCCTCCTCACCATTGTC TGCTGCCCTCTCTCTCTCTC (AT)9 55 °C
RM20A 12 0 ATCTTGTCCCTGCAGGTCAT GAAACAGAGGCACATTTCATTG (ATT)14 55 °C
RM511 12 59.8 CTTCGATCCGGT GACGAC AACGAAAGCGAAGCTGTCTC (GAC)7 55 °C
RM309 12 74.5 GTAGATCACGCACCTTTCTGG AGAAGGCCTCCGGTGAAG (GT)13 55 °C
RM519 12 94.8 AGAGAGCCCCTAAATTTCCG AGGTACGCTCACCTGTGGAC (AAG)8 55 °C