Skip to main content

Table 1 Sequencing primers and annealing temperatures used for PCR amplification of dog WFS1 gene regions

From: The molecular effect of a polymorphic microRNA binding site of Wolfram syndrome 1 gene in dogs

Sequencing primers Forward primer Reverse primer Product lenght (base pairs) TA (°C)
Primer pair 1 CACCCCTGCCACATCCGCAA CGGCCACGTCGACTCCCAAC 525 59
Primer pair 2 GTCCTGCAGCCCCGGCAATG GCGACCAGAGGTGTCCGCAG 531 59
Primer pair 3 GGCCGCGGAGGAGCTATGC CCACGTCGACTCCCAACGCT 562 60
Primer pair 4 ACGGCCGCGGAGGAGCTATG GTTCCTGTGGTGCTGGTGCCC 537 60
Primer pair 5 CGGAGGAGCTATGCCGCCTGA GCTGCAGGCAGTTCCTGTGGT 540 60