Skip to main content

Table 2 Characteristics of the microsatellite markers and their genetic variation statistics in P. sinensis

From: Genetic diversity and structure of Chinese grass shrimp, Palaemonetes sinensis, inferred from transcriptome-derived microsatellite markers

Locus name Forward primer sequence(5′-3′) Reverse primer sequence(5′-3′) Repeat
unit
Annealing
temperature
Size
range (bp)
N A N E H o H e A r r F IS P HWE
c119_g1_i1 F:GGGAGGAGTTTCGTATTCGTT R:TTTTGCCTCCTCTTTTCAGG (TGA)5 54 °C 251–263 4 1.096 0.072 0.087 2.462 0.021 0.160 0.278
c251_g1_i1 F:TGAATGACGTCACGGTTGTT R:CGTGGAGATGTGGGAGTGTA (AC)8 54 °C 236–248 7 1.654 0.335 0.395 4.479 0.042 0.134 0.008**
c317_g1_i1 F:GGGATGGCCTGTAAAGTTGA R:CACCTCCAGTCTCAAAAGCC (CAT)5 54 °C 269–275 5 1.128 0.100 0.114 2.946 0.014 0.072 0.144
c341_g1_i1 F:GCTGTTGAGCACTTTCATTCA R:GGGCTCATGTTAAATCCAAGA (TA)7 54 °C 258–272 9 1.938 0.295 0.484 4.407 0.068 0.211 0.000**
c864_g1_i1 F:GATGCGATAGATGACGCCTT R:ATGCTTAGGTGGTGGAGTGG (TGA)6 54 °C 263–272 4 1.204 0.185 0.169 2.563 0.000 −0.178* 0.973
c1089_g1_i1 F:GTGATCCAGGTCGAACACAA R:TTCTACCCGGTGCTTTTGAC (GGA)5 54 °C 196–201 5 2.005 0.430 0.501 2.707 0.044 0.055* 0.000**
c870_g2_i1 F:TGGTTCTATCCGCAGATTCC R:CCTTCCTGTTGGTGGTGTCT (TCA)6 54 °C 189–192 2 1.137 0.072 0.120 1.994 0.003 0.065* 0.000**
c679_g1_i1 F:TTTGCTGGCAAGGAACATTA R:AGATCACCCCTCTTCCTTCC (AGG)5 54 °C 92–114 4 2.887 0.596 0.654 3.838 0.022 0.035* 0.194
c792_g1_i1 F:TTGGCTTCAGCAAATCCTTT R:TCCTTTCGCTTTTGATACCAG (AT)6 54 °C 198–208 6 1.643 0.235 0.391 2.991 0.094 0.325* 0.000**
c102_g1_i1 F:TGGTGATGGGGATTTCCTTA R:TTCTTTTATTGTCTGATTATGCCA (AT)6 54 °C 256–264 5 1.930 0.282 0.482 4.813 0.094 0.246* 0.000**
c1157_g2_i1 F:ATGTCGGAACGGACAGAAAA R:TGAAGCAGAGGAAACGTTGA (GA)7 54 °C 105–109 3 2.305 0.254 0.566 3.000 0.093 0.333* 0.000**
c1198_g1_i1 F:TCTGGAAAATTTTTGGGCAC R:GAAATTAAGGTTTAGCACATTCTCC (TA)7 54 °C 165–201 6 3.136 0.430 0.681 4.326 0.131 0.320* 0.000**
c1730_g1_i1 F:TGAAATTCCAGGAAAGGCTG R:CGTGTCCTTCCACGAAAGAG (GGA)5 54 °C 191–209 13 3.291 0.511 0.696 6.042 0.043 0.094 0.055
c1747_g1_i1 F:CAGGAGACCATGTAGAATTACGC R:TTTGATGACAACGTGGCACT (CA)7 54 °C 186–222 13 3.628 0.542 0.724 7.478 0.046 0.081* 0.000**
c2017_g1_i1 F:GTGATTTGACGTGACGAACG R:AGACTGCAGGAGAGGCTCAG (GAT)6 54 °C 253–271 5 1.139 0.129 0.122 3.021 0.000 −0.097* 1.000
c2591_g1_i1 F:GCATCAGAAACTTGGAGCCT R:ACAGTAGCTAGGGGGCTTGG (TG)10 54 °C 148–154 2 1.006 0.006 0.006 1.213 0.001 −0.013* 1.000
  1. NA: number of alleles; NE: number of effective alleles; Ho: observed heterozygosity; He: excepted heterozygosity; Ar: allele richness; r: null allele frequency; FIS: inbreeding coefficient, *Significance value from 95% confidence interval; PHWE: P-value for deviation from Hardy-Weinberg equilibrium, ** highly significant (P < 0.01)