Skip to main content

Table 2 Mutation vector construction of BMP7 3’UTR

From: Preliminary study on microR-148a and microR-10a in dermal papilla cells of Hu sheep

Name Primer sequence
Oar-BMP7-MUT1-F TCAGCCGACGTACCACTCGTTCCCAGGGTAA
Oar-BMP7-MUT1-R GAACGAGTGGTACGTCGGCTGAGACTTCACAGC
Oar-BMP7-MUT2-F CTCGTTCCGTCCCGTAATACGACACTCTTCA
Oar-BMP7-MUT2-R GTAATTACGGGACGGAACGAGTCAGTGCACG
  1. Note: The underline means mutation sequence
\