Skip to main content

Table 1 Amplification primers information of BMP7 3’UTR sequence

From: Preliminary study on microR-148a and microR-10a in dermal papilla cells of Hu sheep

Name Primer Length/bp
BMP7-F(XhoI) GCGGCTCGAGCTCTTCCTGGAAGTCACACGCTT 480
BMP7-R(NotI) AATGCGGCCGCTTTTTTTTTTTTCATCATCGTTTTA
  1. Note: The underline is the enzyme cleavage site, and the sequence before underline is the protection base
\