Skip to main content

Table 3 Multiplex and reaction conditions for optimized white-tailed deer microsatellite panel

From: Identification and evaluation of a core microsatellite panel for use in white-tailed deer (Odocoileus virginianus)

Locus Primer Sequence Motif Vol Dye AT
Multiplex 1
 RT9 F: TGAAGTTTAATTTCCACTCT
R: CAGTCACTTTCATCCCACAT
2 0.20 6-FAM 57.0
 BM4107 F: AGCCCCTGCTATTGTGTGAG
R: ATAGGCTTTGCATTGTTCAGG
2 0.18 6-FAM 57.0
 P F: TTTCACTGTTTTCTCCTTCAGA
R: TGCCCAATCAGATGTTGTAG
4 0.20 NED 57.0
 Cervid 1 F: AAATGACAACCCGCTCCAGTATC
R: TCCGTGCATCTCAACATGAGTTAG
2 0.15 NED 64.0
Multiplex 2
 Q F: AATGTGTCAGTGAAGGTCTTC
R: ATCCAGGCAACCATCTAG
4 0.18 6-FAM 60.0
 RT5 F: CAGCATAATTCTGACAAGTG
R: GTTGAGGGGACTCGACTG
2 0.16 6-FAM 60.0
 BL42 F: ACAAGTCAAGGTCAAGTCCAAATGCC
R: CGATTTTTGTGTTAATTTCATGC
2 0.20 PET 54.0
Multiplex 3
 RT7 F: CCTGTTCTACTCTTCTTCTC
R: ACTTTTCACGGGCACTGGTT
2 0.15 VIC 55.0
 BM6438 F: TTGAGCACAGACACAGACTGG
R: ACTGAATGCCTCCTTTGTGC
2 0.17 NED 55.0
 INRA011 F: CGAGTTTCTTTCCTCGTGGTAGGC
R: GCTCGGCACATCTTCCTTAGCAAC
2 0.17 PET 55.0
 OarFCB193 F: TTCATCTCAGACTGGGATTCAGA
R: GCTTGGAAATAACCCTCCTGC
2 0.18 NED 55.0
  1. All primers were multiplexed for PCR and fragment analysis steps with the exception of Cervid 1 and BL42 (). Polymerase chain reactions for these two loci were run separately and then multiplexed for fragment size analysis. Primers are grouped by multiplex with Motif = expected repeat motifs, Vol = volume of primer mix (μL) for 10 μL reaction volume consisting of equal parts 20 μM forward and reverse primer, Dye = dye color, and AT = annealing temperature (°C)