Skip to main content

Table 1 Primers used to amplify the TYR gene, the D-loop and Cytochrome b

From: A novel nonsense mutation in the tyrosinase gene is related to the albinism in a capuchin monkey (Sapajus apella)

Gene Primer Annealing temperature Nucleotide sequence
1TYR Exon 1 TYR11Fw 59 5' CCAATTAGCCAGTTCCTGCAGA 3'
TYR11Rv 5' CACAGTTGAATCCCATGAAGTTGC 3'
TYR12Fw 57 5' TATAATAGGACCTGCCAGTGCTCTG 3'
Tyr12Rv 5' AATGTCTCTCAAGATTTCAGATCCC 3'
Tyr13Fw 60 5' TGTGTCAATGGATGCACTGCTT 3'
Tyr13Rv 5' AGAAGTGATTGTTAAGGTTCCTCCC 3'
1TYR Exon 2 Tyr2Fw 60 5' TTGTTTAACATGAGGGTGTTTTGTACAG 3'
Tyr2Rv 5' GGACTTTGGATAAGAGACTGTAAATATG 3'
TYR Exon 3 Tyr3SbFw 59 5' TCCATTTACTGGGATAGCAGATG 3'
Tyr3SbRv 5' GTGAAGAAGGAAGATGGGATCAT 3'
TYR Exon 4 Tyr4SbFw 59 5' GAAGGCATCGCCCTCTTCTA 3'
Tyr4SbRv 5' AGGTAGCTATAGTCATAGCCCAGA 3'
TYR Exon 5 Tyr5SbFw 60 5' CCCAGACTCTTTTCAAGACTAACATT 3'
Tyr5SbRv 5' AATAAAGATGGGGCCAATAAAAA 3'
2D-loop L 60 5' GGCCTTGTAAACCGGAAAAGG 3'
R 5' GAAAGGCTAGGACCAAACCTG 3'
3CytB L14724 58 5' CGAAGCTTGATATGAAAAACCATCGTTG 3'
CIT-REV 5' GAATATCAGCTTTGG 3'
  1. 1Preising et al. [27]; 2Schneider et al. [40]; 3Irwin et al. [41]
\