Skip to main content

Table 4 Haplotypes in the 58.5 Mb–60.5 Mb region on chromosome 15 and their association (b) with pH

From: Whole-genome association analysis of pork meat pH revealed three significant regions and several potential genes in Finnish Yorkshire pigs

Haplotype Nucleotides1 Frequency2 b SE P-value
1 GAGGGAAAGGGGAAGAACAAAGGAGAGGGAGAAAG 0.25 8.59E-03 4.59E-03 NS3
2 GAGGGAAGAAGGAAAGACAAAAGAGAAAGAGAAAG 0.22 4.30E-03 4.36E-03 NS
3 GAGGAGGGAGGGAAGGACAAGAAAGAAGGAGAAAG 0.16 1.07E-03 5.38E-03 NS
4 GAGGAGGGAGGGGAAGACAAGAAGAGGAGAGAAAG 0.13 5.58E-03 5.42E-03 NS
5 GAGGGAAAGGGGGAAGACAAGAAGAGGAGAGAAAG 0.08 -5.27E-03 6.26E-03 NS
6 GGAAGAAAGGGGAAGACGGGAGGAGAAAGGAAGAA 0.05 -3.63E-02 8.00E-03 6.69E-06
7 AAGGGGGGAGAAGGGGCCGGGGGAAGGGAAGAGAG 0.05 -2.15E-02 8.98E-03 0.02
8 GAGGAGGGAAGGAAGGCGAAGAGAGAAAGAGAAAG 0.03 -2.25E-03 1.43E-02 NS
9 GAGGGAAAGGGGGAAGACAAGAGGGAAGGGAGACG 0.03 2.15E-02 1.12E-02 NS
  1. 1The SNPs are: INRA0049382, ALGA0112278, ASGA0106157, MARC0098560, DRGA0015140, DRGA0015141, ALGA0085422, MARC0044358, ALGA0085430, ALGA0085436, ALGA0085439, INRA0049399, ALGA0085441, ALGA0085442, MARC0043488, DRGA0015145, ASGA0069641, ALGA0085445, H3GA0044376, ALGA0085452, MARC0000855, ASGA0069644, ALGA0085462, H3GA0044381, INRA0049414, H3GA0044383, MARC0071088, ALGA0085464, ALGA0085465, MARC0073466, INRA0049417, DRGA0015149, ASGA0069650, ALGA0085471, ASGA0069653. 2Only haplotypes with a frequency greater than 1% are presented. 3NS = not significant