Skip to main content

Table 1 Primer combinations used for amplification of MHC IIB

From: Molecular characterization of MHC class IIB genes of sympatric Neotropical cichlids

Forward Primer Reverse Primer TA Fragment
SatoGa11_mod1 MHC Rev3 59 °C E2 - E3
 AACTCCACKGAKCTGAAGRAC  GATCTGTTTGGGGTAGAAGTCG   
GAIIEx2startF MHC Rev3 55 °C E2 - E3
 GTCTTTAACTCCACGGAGCTGAAGG  GATCTGTTTGGGGTAGAAGTCG   
GAIIEx2startF AcMHCIIBR1 59 °C E2 - E3
 GTCTTTAACTCCACGGAGCTGAAGG  GGRGTGAAGTCTGACTRATGG   
AaMHCIIBE1F1b MHC Rev3 56 °C E1 - E3
 ATGGCTYCATCCTTYMTC  GATCTGTTTGGGGTAGAAGTCG   
AaMHCIIBE1F1b AcMHCIIBR4 59 °C E1 - E5
 ATGGCTYCATCCTTYMTC  ACCCAGGATCAGTCCTGAGG   
AcMHCIIBF2 (excludes group I) AcMHCIIBR3 (excludes gop I) 64 °C E2 - E2/I2
 TTAACTCCACKGAGCTGAASGACA  GAYGATGAAYCATAACTCACCTGAT   
AcMHCIIBF3 (only group I) AcMHCIIBR4 46 °C E2/I2 - E5
 TCAGGTGAGTYATGDTTCATC  ACCCAGGATCAGTCCTGAGG   
AcMHCIIBF3 (only group I) AcMHCIIBR5 44 °C E2/I2 - R5
 TCAGGTGAGTYATGDTTCATC  TTCCTCTTGTAGTAGATGAATCC   
AcMHCIIBF4 (excludes goup I) AcMHCIIBR4 54 °C E2/I2 - E5
 TCAGGTGAGTCTGTTTCTGTG  ACCCAGGATCAGTCCTGAGG   
AcMHCIIBF5 (excludes group I) MHC Rev3 55 °C E2 - E3
 CCACKGAGCTGAASGACATSGAG  GATCTGTTTGGGGTAGAAGTCG   
AcMHCIIBF5 (excludes group I) AcMHCIIBR4 59 °C E2 - E5
 CCACKGAGCTGAASGACATSGAG  ACCCAGGATCAGTCCTGAGG   
AcMHCIIBF7 AcMHCIIBR9 50 °C E2 - E2
 CGAGTACGTTCGATCTTTGTATTGC  DCTGATTTAGTCAGAGCAGTCT   
AcMHCIIBF8 AcMHCIIBR9 55 °C E2 - E2
 CGAGTWCATCARVTCTTACTAYTWC  DCTGATTTAGTCAGAGCAGTCT   
AcMHCIIBF9 AcMHCIIBR8 NA I2 - I2
 GAAACCTGTTCACAGCAGTCCCTC  CATGTGCTACATGCAACATATCA   
AcMHCIIBF6 MHC Rev3 55 °C E2 - E3
 CCACTGAGCTGAASGACATSGAG  GATCTGTTTGGGGTAGAAGTCG   
  1. Fragment indicates the region of the gene amplified: ‘E’ exon, ‘I’ intron, ‘/’ exon-intron boundary. The primers AcMHCIIBF9 and AcMHCIIBR8 were used only to sequence through clones with long intron 2