Skip to main content

Table 1 List of oligonucleotide probes tested in EMSA

From: Regulatory single nucleotide polymorphisms (rSNPs) at the promoters 1A and 1B of the human APC gene

SNP identifier in dbSNP NCBI database Sequences of oligonucleotides 5’- > 3’ Coordinates (hg19) Minor Allele Count (MAF) Promoter
Rs75612255: T > C Allele T: ATTTATTACTCTCCCTCCCACCTCCGGCATC
Allele C: ATTTATTACTCTCCCCCCCACCTCCGGCATC
Chr5:112737543
(−316), 5'-flank
NA 1A
Rs79734816: T > C Allele T: TCTGCCCTGCGGACCTCCCCCGACTCTTTAC
Allele C: TCTGCCCTGCGGACCCCCCCCGACTCTTTAC
Chr5: 112737587
(−272), 5'-flank
NA 1A
Rs77733015: T > G Allele T: GGGCTAGGCAGGCTGTGCGGTTGGGCGGGGC
Allele G: GGGCTAGGCAGGCTGGGCGGTTGGGCGGGGC
Chr5: 112737699
(−160), 5'-flank
NA 1A
Rs78597499: T > G Allele T: AGGCAGGCTGTGCGGTTGGGCGGGGCCCTGT
Allele G: AGGCAGGCTGTGCGGGTGGGCGGGGCCCTGT
Chr5: 112737704
(−155), 5'-flank
NA 1A
Rs35417795: 112737713delG Allele del: GTGCGGTTGGGCGGG-CCCTGTGCCCCACTG
Allele G: GTGCGGTTGGGCGGGGCCCTGTGCCCCACTG
Chr5: 112737713
(−146), 5'-flank
NA 1A
Rs113017087: T > C Allele T: GTGTAATCCGCTGGATGCGGACCAGGGCGCT
Allele C: GTGTAATCCGCTGGACGCGGACCAGGGCGCT
Chr5: 112737780
(−79), 5'-flank
C = 0.0032/16 1A
Rs75996864: T > G Allele C: ACCGACATGTGGCTGTATTGGTGCAGCCCGC
Allele G: ACCGACATGTGGCTGGATTGGTGCAGCCCGC
Chr5: 112737860
(1), 5'-UTR
NA 1A
Rs115242894: G > C Allele G: GTATTGGTGCAGCCCGCCAGGGTGTCACTGG
Allele C: GTATTGGTGCAGCCCCCCAGGGTGTCACTGG
Chr5: 112737874
(15), 5'-UTR
C = 0.0042/21 1A
Rs80112297: A > G Allele A: GCTTGCTGCGGGGGGAGGGGGGAAGGTGGTT
Allele G: GCTTGCTGCGGGGGGGGGGGGGAAGGTGGTT
Chr5: 112737967
(108), intron
NA 1A
Rs76241113: A > G Allele A: GCGGGGGGAGGGGGGAAGGTGGTTTTCCCTC
Allele G: GCGGGGGGAGGGGGGGAGGTGGTTTTCCCTC
Chr5: 112737974
(115), intron
NA 1A
Rs80313086: T > G Allele T: GGGGAGGGGGGAAGGTGGTTTTCCCTCGCAC
Allele G: GGGGAGGGGGGAAGGGGGTTTTCCCTCGCAC
Chr5: 112737978
(119), intron
NA 1A
Rs115658307: C > T Allele C: CAAGATGGCGGAGGGCAAGTAGCAAGGGGGC
Allele T: CAAGATGGCGGAGGGTAAGTAGCAAGGGGGC
Chr5: 112707537
(33), 5'-UTR
T = 0.0054/27 1B
Rs138386816: C > T Allele C: GCGGGGTGTGGCCGCCGGAAGCCTAGCCGCT
Allele T: GCGGGGTGTGGCCGCTGGAAGCCTAGCCGCT
Chr5: 112707566
(62), 5'-UTR
T = 0.0088/44 1B
Rs79896135: C > G Allele C: AGCCTAGCCGCTGCTCGGGGGGGACCTGCGG
Allele G: AGCCTAGCCGCTGCTGGGGGGGGACCTGCGG
Chr5: 112707585
(81), 5'-UTR
G = 0.1777/890 1B
Rs78429131: T > G Allele T: AGGAAGGTGAAGCACTCAGTTGCCTTCTCGG
Allele G: AGGAAGGTGAAGCACGCAGTTGCCTTCTCGG
Chr5: 112707687
(183), 5'-UTR
G = 0.0767/384 1B