Skip to main content

Table 1 Primers used in this study

From: Haynaldia villosa NAM-V1 is linked with the powdery mildew resistance gene Pm21 and contributes to increasing grain protein content in wheat

Primer name Primer sequence (5′-3′) Product length Annealing Temperature Purpose
NAMORF1 F: GATGAGGTCCATGGGCAG 1528 bp 60 °C Genomic DNA cloning
R: TCATTTGCTCAGGGATTCC
NAMORF2 F: ATGGGCAGCTCCGACTCA 1540 bp 60 °C cDNA cloning
R: TCAGGGATTCCAGTTCACG
CauNAM-V1 F: TCCCCGGTATGCCATGTC 575 bp 58 °C Specific molecular marker for NAM-V1
R: AAGATACCGCTAGACCGTGA
CauNAM-ABD F: TACAAGTTCGACCCATGGGA 265 -294 bp 58 °C Molecular marker for NAM-A1, B1, D1, B2 and D2
R: GCGCGGGCTGAAGAAGTA