Skip to main content

Table 1 Specific primers used in Q-PCR

From: MicroRNA profiles reveal female allotetraploid hybrid fertility

Primer Sequence
miR-6843-3p-RT CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCAGCAT
miR-6843-3p-F ACACTCCAGCTGGGTTGGTCTCTGTA
miR-81b-5p-RT CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGACTGTGA
miR-81b-5p-F ACACTCCAGCTGGGCCGGGTGTGTGTT
miR-42-5p-RT CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGACTGTGA
miR-42-5p-F ACACTCCAGCTGGGCTGGGTGTGTGCT
miR-21-5p-RT CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGGCCAACAC
miR-21-5p-F ACACTCCAGCTGGGTAGCTTATCAGACT
miR-2368-3p-RT CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAAAAAGCC
miR-2368-3p-F ACACTCCAGCTGGGGCTGTCAGAAAGGG
Actin-RTF TCTACAACGAGCTGCGTGTTG
Actin-RTR CCTGTTGGCTTTGGGATTGA